Incidental Mutation 'R5188:Srp72'
ID398010
Institutional Source Beutler Lab
Gene Symbol Srp72
Ensembl Gene ENSMUSG00000036323
Gene Namesignal recognition particle 72
Synonyms72kDa, 5730576P14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5188 (G1)
Quality Score208
Status Not validated
Chromosome5
Chromosomal Location76974683-76999937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76974751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 10 (S10T)
Ref Sequence ENSEMBL: ENSMUSP00000113312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]
Predicted Effect probably benign
Transcript: ENSMUST00000101087
AA Change: S10T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: S10T

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 70 2.7e-2 PFAM
Pfam:SRP_TPR_like 30 157 5.5e-25 PFAM
Pfam:TPR_8 176 208 2.3e-3 PFAM
Pfam:TPR_1 226 259 2.4e-4 PFAM
Pfam:TPR_2 226 259 4.9e-5 PFAM
Pfam:TPR_8 226 259 1.1e-2 PFAM
Pfam:TPR_9 412 490 1.3e-3 PFAM
Pfam:SRP72 531 588 6.2e-26 PFAM
low complexity region 630 639 N/A INTRINSIC
low complexity region 647 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120550
AA Change: S10T

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323
AA Change: S10T

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 72 2.5e-2 PFAM
Blast:TPR 109 142 2e-11 BLAST
Blast:TPR 176 209 5e-10 BLAST
Pfam:TPR_6 280 310 2.5e-3 PFAM
Pfam:TPR_9 351 429 1.4e-3 PFAM
Pfam:SRP72 465 527 5.8e-24 PFAM
low complexity region 569 578 N/A INTRINSIC
low complexity region 586 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150661
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Srp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Srp72 APN 5 76984176 missense probably damaging 1.00
IGL00915:Srp72 APN 5 76978613 nonsense probably null
IGL02731:Srp72 APN 5 76994215 missense probably damaging 0.98
PIT4468001:Srp72 UTSW 5 76994206 missense probably benign
R0009:Srp72 UTSW 5 76987885 missense probably damaging 0.98
R0318:Srp72 UTSW 5 76984200 missense probably benign 0.27
R1645:Srp72 UTSW 5 76998278 missense probably benign 0.05
R1678:Srp72 UTSW 5 76980307 missense probably damaging 1.00
R1682:Srp72 UTSW 5 76987870 missense possibly damaging 0.95
R2037:Srp72 UTSW 5 76976491 missense probably damaging 1.00
R2364:Srp72 UTSW 5 76984362 missense probably benign 0.00
R2876:Srp72 UTSW 5 76995920 splice site probably benign
R4072:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4073:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4074:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4638:Srp72 UTSW 5 76990295 missense probably benign 0.00
R4803:Srp72 UTSW 5 76984384 missense probably damaging 0.97
R4864:Srp72 UTSW 5 76984162 missense probably benign 0.35
R5217:Srp72 UTSW 5 76980528 missense probably damaging 1.00
R5459:Srp72 UTSW 5 76984338 missense probably benign 0.16
R5616:Srp72 UTSW 5 76987934 missense probably damaging 1.00
R6460:Srp72 UTSW 5 76987991 missense probably damaging 1.00
R6595:Srp72 UTSW 5 76984200 missense probably benign 0.27
R6959:Srp72 UTSW 5 76994223 missense possibly damaging 0.91
R6986:Srp72 UTSW 5 76994876 missense probably benign 0.16
R7674:Srp72 UTSW 5 76974826 missense probably damaging 0.98
Z1177:Srp72 UTSW 5 76998353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTGACGCTAGCTCTGGG -3'
(R):5'- AAGTACACGTGGCCTTAAGC -3'

Sequencing Primer
(F):5'- TGGGACAGACCAGCTCG -3'
(R):5'- TGGCCTTAAGCGACCGAG -3'
Posted On2016-07-06