Incidental Mutation 'R5188:Prh1'
ID398013
Institutional Source Beutler Lab
Gene Symbol Prh1
Ensembl Gene ENSMUSG00000059934
Gene Nameproline rich protein HaeIII subfamily 1
SynonymsA-type, Prp, MP2
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132569809-132572941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132571707 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 59 (Q59R)
Ref Sequence ENSEMBL: ENSMUSP00000135877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074042] [ENSMUST00000111972] [ENSMUST00000177523]
Predicted Effect unknown
Transcript: ENSMUST00000074042
AA Change: Q59R
SMART Domains Protein: ENSMUSP00000073689
Gene: ENSMUSG00000059934
AA Change: Q59R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 20 44 N/A INTRINSIC
low complexity region 49 244 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111972
AA Change: Q59R
SMART Domains Protein: ENSMUSP00000107603
Gene: ENSMUSG00000059934
AA Change: Q59R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 20 44 N/A INTRINSIC
low complexity region 49 272 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177523
AA Change: Q59R
SMART Domains Protein: ENSMUSP00000135877
Gene: ENSMUSG00000059934
AA Change: Q59R

DomainStartEndE-ValueType
Pfam:Pro-rich 1 88 3.7e-9 PFAM
low complexity region 278 289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The expression of this gene is dramatically induced in the parotid and submandibular glands of mice by beta-adrenergic stimulation. The encoded protein serves an important dental function by protecting mice against toxic dietary polyphenols such as tannins and influence the visco-elastic properties of the mucus. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 6. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Prh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02635:Prh1 APN 6 132572283 missense unknown
R0583:Prh1 UTSW 6 132571833 missense unknown
R4434:Prh1 UTSW 6 132571878 missense unknown
R5868:Prh1 UTSW 6 132572211 missense unknown
R6522:Prh1 UTSW 6 132572033 missense unknown
R7293:Prh1 UTSW 6 132571758 missense unknown
R8084:Prh1 UTSW 6 132571859 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCCATGTTTTAACGGGAG -3'
(R):5'- CTATGCTGTGGGCCTCCTG -3'

Sequencing Primer
(F):5'- AAAATGCTGTGTGGAAGGGTCATTG -3'
(R):5'- GCCTCCTGGTGGTGGTG -3'
Posted On2016-07-06