Incidental Mutation 'R5188:Olfr150'
ID398014
Institutional Source Beutler Lab
Gene Symbol Olfr150
Ensembl Gene ENSMUSG00000094353
Gene Nameolfactory receptor 150
SynonymsGA_x6K02T2PVTD-33434302-33435240, MOR171-18, M93
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39730978-39738456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39737235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Ref Sequence ENSEMBL: ENSMUSP00000150024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078557] [ENSMUST00000217257]
Predicted Effect probably benign
Transcript: ENSMUST00000078557
AA Change: V140A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000077635
Gene: ENSMUSG00000094353
AA Change: V140A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-50 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217257
AA Change: V140A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Olfr150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Olfr150 APN 9 39737499 missense probably damaging 1.00
IGL01110:Olfr150 APN 9 39737397 missense probably benign 0.00
IGL01343:Olfr150 APN 9 39737715 missense probably damaging 0.99
IGL01942:Olfr150 APN 9 39737666 missense possibly damaging 0.90
IGL02044:Olfr150 APN 9 39736974 missense possibly damaging 0.94
PIT4486001:Olfr150 UTSW 9 39737239 nonsense probably null
R1178:Olfr150 UTSW 9 39737346 missense probably damaging 1.00
R1451:Olfr150 UTSW 9 39737316 missense probably benign 0.00
R1672:Olfr150 UTSW 9 39737196 missense probably damaging 1.00
R1916:Olfr150 UTSW 9 39737622 missense probably benign 0.06
R2095:Olfr150 UTSW 9 39737261 missense probably damaging 0.98
R2116:Olfr150 UTSW 9 39737304 missense probably damaging 0.98
R4183:Olfr150 UTSW 9 39737048 missense probably benign 0.01
R4259:Olfr150 UTSW 9 39737703 missense probably damaging 1.00
R4590:Olfr150 UTSW 9 39736850 missense probably damaging 1.00
R6158:Olfr150 UTSW 9 39737076 missense probably benign
R6361:Olfr150 UTSW 9 39737672 missense probably damaging 1.00
R6807:Olfr150 UTSW 9 39737618 nonsense probably null
R6977:Olfr150 UTSW 9 39737034 missense probably benign 0.01
R7412:Olfr150 UTSW 9 39737126 missense probably benign 0.24
R8755:Olfr150 UTSW 9 39737490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGTCCTTCATTGAC -3'
(R):5'- ACCTCATTGACATAAGTACTGGAGC -3'

Sequencing Primer
(F):5'- CACCCCTAAAATGCTGGTGAACTTTG -3'
(R):5'- GCAGGCAAGCTCCATCAATG -3'
Posted On2016-07-06