Incidental Mutation 'R5188:2700049A03Rik'
ID 398021
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene Name RIKEN cDNA 2700049A03 gene
Synonyms talpid3, Ta3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5188 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 71183622-71290077 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71211321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 685 (E685V)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
AlphaFold E9PV87
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,330,651 (GRCm39) I1335F probably benign Het
Amigo3 C A 9: 107,931,882 (GRCm39) A435E probably damaging Het
Atr T A 9: 95,803,778 (GRCm39) N1871K probably benign Het
Ctsw C T 19: 5,517,120 (GRCm39) A71T probably damaging Het
Decr1 C T 4: 15,924,270 (GRCm39) V217M probably damaging Het
Golgb1 A G 16: 36,738,827 (GRCm39) T2389A probably benign Het
Gpr151 A G 18: 42,711,820 (GRCm39) M286T probably benign Het
Katnbl1 T A 2: 112,240,499 (GRCm39) I262N probably damaging Het
Lrp1 A G 10: 127,443,821 (GRCm39) C149R probably damaging Het
Mpc1 A T 17: 8,515,215 (GRCm39) probably benign Het
Ndufv1 A T 19: 4,059,988 (GRCm39) N37K probably damaging Het
Or1n1b T A 2: 36,780,405 (GRCm39) I152L probably benign Het
Or5af2 C A 11: 58,708,146 (GRCm39) T104K probably damaging Het
Or8g50 T C 9: 39,648,531 (GRCm39) V140A probably benign Het
Or8k1 T G 2: 86,047,521 (GRCm39) S178R probably benign Het
Pnpla7 C A 2: 24,887,312 (GRCm39) P52Q probably benign Het
Prh1 A G 6: 132,548,670 (GRCm39) Q59R unknown Het
Ren1 A G 1: 133,278,351 (GRCm39) probably benign Het
Rnf148 T C 6: 23,654,139 (GRCm39) T286A probably damaging Het
Sdk1 T C 5: 141,942,015 (GRCm39) probably null Het
Srp72 T A 5: 77,122,598 (GRCm39) S10T possibly damaging Het
Stk11 G T 10: 79,962,113 (GRCm39) G215V probably damaging Het
Stk4 T C 2: 163,930,828 (GRCm39) M143T possibly damaging Het
Supt20 T A 3: 54,617,849 (GRCm39) S318T possibly damaging Het
Tchh G C 3: 93,353,986 (GRCm39) R1142P unknown Het
Vipas39 G T 12: 87,301,021 (GRCm39) R161S probably benign Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71,213,893 (GRCm39) missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71,241,242 (GRCm39) critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71,211,152 (GRCm39) splice site probably null
IGL01835:2700049A03Rik APN 12 71,213,957 (GRCm39) missense probably benign 0.00
IGL01835:2700049A03Rik APN 12 71,213,955 (GRCm39) nonsense probably null
IGL02122:2700049A03Rik APN 12 71,217,299 (GRCm39) missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71,195,034 (GRCm39) missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71,201,630 (GRCm39) missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71,240,147 (GRCm39) missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71,187,657 (GRCm39) missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71,205,599 (GRCm39) splice site probably benign
G4846:2700049A03Rik UTSW 12 71,184,683 (GRCm39) missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71,207,160 (GRCm39) missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71,217,440 (GRCm39) missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71,224,692 (GRCm39) missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71,213,924 (GRCm39) missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71,195,194 (GRCm39) critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71,184,804 (GRCm39) missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71,240,084 (GRCm39) missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71,211,162 (GRCm39) missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71,224,642 (GRCm39) missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71,205,657 (GRCm39) missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71,266,082 (GRCm39) splice site probably benign
R1244:2700049A03Rik UTSW 12 71,262,918 (GRCm39) missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71,217,361 (GRCm39) splice site probably null
R1599:2700049A03Rik UTSW 12 71,197,033 (GRCm39) missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71,265,995 (GRCm39) missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71,197,018 (GRCm39) missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71,207,186 (GRCm39) splice site probably null
R1998:2700049A03Rik UTSW 12 71,235,393 (GRCm39) missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2337:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2340:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2382:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2384:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2445:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2449:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2512:2700049A03Rik UTSW 12 71,219,945 (GRCm39) missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71,201,530 (GRCm39) splice site probably benign
R3236:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3236:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3237:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3734:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3809:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3944:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3960:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4593:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4595:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4596:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71,195,037 (GRCm39) missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4649:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4652:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4714:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4735:2700049A03Rik UTSW 12 71,262,897 (GRCm39) missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71,236,216 (GRCm39) missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4852:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4854:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4893:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4905:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71,236,420 (GRCm39) missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4919:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4989:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5011:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5118:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71,289,799 (GRCm39) missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5163:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,240,123 (GRCm39) missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5190:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71,235,565 (GRCm39) missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71,289,801 (GRCm39) missense probably benign
R5502:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5502:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5503:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5619:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5667:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5669:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71,240,093 (GRCm39) missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71,203,893 (GRCm39) missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71,231,304 (GRCm39) missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71,234,200 (GRCm39) missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71,217,410 (GRCm39) missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71,211,318 (GRCm39) missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71,263,004 (GRCm39) splice site probably null
R7168:2700049A03Rik UTSW 12 71,262,831 (GRCm39) missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71,265,963 (GRCm39) critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71,187,680 (GRCm39) missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71,236,348 (GRCm39) missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71,197,179 (GRCm39) missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7922:2700049A03Rik UTSW 12 71,211,180 (GRCm39) missense possibly damaging 0.83
R7966:2700049A03Rik UTSW 12 71,219,903 (GRCm39) missense probably benign 0.00
R8082:2700049A03Rik UTSW 12 71,188,895 (GRCm39) critical splice donor site probably null
R8311:2700049A03Rik UTSW 12 71,184,815 (GRCm39) unclassified probably benign
R8408:2700049A03Rik UTSW 12 71,236,356 (GRCm39) missense possibly damaging 0.71
R8852:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R8860:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R9039:2700049A03Rik UTSW 12 71,213,849 (GRCm39) missense possibly damaging 0.51
R9281:2700049A03Rik UTSW 12 71,205,687 (GRCm39) missense possibly damaging 0.51
R9308:2700049A03Rik UTSW 12 71,231,233 (GRCm39) missense probably benign 0.23
R9385:2700049A03Rik UTSW 12 71,207,966 (GRCm39) missense possibly damaging 0.52
R9412:2700049A03Rik UTSW 12 71,235,457 (GRCm39) missense possibly damaging 0.71
R9643:2700049A03Rik UTSW 12 71,211,189 (GRCm39) missense possibly damaging 0.92
R9676:2700049A03Rik UTSW 12 71,207,905 (GRCm39) missense possibly damaging 0.86
R9776:2700049A03Rik UTSW 12 71,235,448 (GRCm39) missense possibly damaging 0.71
R9789:2700049A03Rik UTSW 12 71,231,357 (GRCm39) missense probably benign
Z1177:2700049A03Rik UTSW 12 71,211,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- TGTTCCCTGGCAGATAACG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'
Posted On 2016-07-06