Incidental Mutation 'R5188:Vipas39'
ID398022
Institutional Source Beutler Lab
Gene Symbol Vipas39
Ensembl Gene ENSMUSG00000021038
Gene NameVPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87238868-87266256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87254247 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 161 (R161S)
Ref Sequence ENSEMBL: ENSMUSP00000072527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021426] [ENSMUST00000072744] [ENSMUST00000179379]
Predicted Effect probably benign
Transcript: ENSMUST00000021426
SMART Domains Protein: ENSMUSP00000021426
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072744
AA Change: R161S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072527
Gene: ENSMUSG00000021038
AA Change: R161S

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 489 3.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179379
SMART Domains Protein: ENSMUSP00000137190
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222350
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry and scaly skin, hair loss, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Other mutations in Vipas39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL01418:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL02026:Vipas39 APN 12 87251709 splice site probably benign
IGL03089:Vipas39 APN 12 87253254 missense probably damaging 1.00
R0173:Vipas39 UTSW 12 87250511 splice site probably benign
R0909:Vipas39 UTSW 12 87241331 missense probably benign 0.21
R1505:Vipas39 UTSW 12 87246160 missense probably damaging 1.00
R2897:Vipas39 UTSW 12 87242523 missense possibly damaging 0.78
R2968:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2969:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2970:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R4622:Vipas39 UTSW 12 87244543 missense probably damaging 1.00
R4676:Vipas39 UTSW 12 87241301 missense probably damaging 1.00
R5181:Vipas39 UTSW 12 87239827 missense probably damaging 1.00
R5881:Vipas39 UTSW 12 87251807 nonsense probably null
R6080:Vipas39 UTSW 12 87241953 missense probably damaging 1.00
R6425:Vipas39 UTSW 12 87241289 missense probably damaging 0.98
R6896:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R7438:Vipas39 UTSW 12 87241931 splice site probably null
R7538:Vipas39 UTSW 12 87263903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCTAACTGTGGTGGATTTGC -3'
(R):5'- GTCTGTGTCACCCTTGCTCTAG -3'

Sequencing Primer
(F):5'- GGATTTGCTTTGCTCCTGAAAAC -3'
(R):5'- GAATTCACTCTGTAGACCAAGCTGG -3'
Posted On2016-07-06