Incidental Mutation 'R5188:Mpc1'
ID398025
Institutional Source Beutler Lab
Gene Symbol Mpc1
Ensembl Gene ENSMUSG00000023861
Gene Namemitochondrial pyruvate carrier 1
SynonymsBrp44l, 3830411I18Rik, 0610006G08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8282904-8297661 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 8296383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046754] [ENSMUST00000124023] [ENSMUST00000130559] [ENSMUST00000142594] [ENSMUST00000145402] [ENSMUST00000155364]
Predicted Effect probably benign
Transcript: ENSMUST00000046754
SMART Domains Protein: ENSMUSP00000045654
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 108 2.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123341
Predicted Effect probably benign
Transcript: ENSMUST00000124023
SMART Domains Protein: ENSMUSP00000118386
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 1 85 5.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130559
SMART Domains Protein: ENSMUSP00000116307
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 1 86 7.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137344
Predicted Effect probably benign
Transcript: ENSMUST00000142594
SMART Domains Protein: ENSMUSP00000119901
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:MPC 70 167 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145402
SMART Domains Protein: ENSMUSP00000122214
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 78 5.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147427
Predicted Effect probably benign
Transcript: ENSMUST00000155364
SMART Domains Protein: ENSMUSP00000119443
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 108 2.4e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit altered gluconeogenesis and whole body glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Mpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02687:Mpc1 APN 17 8297143 missense probably benign 0.14
R1897:Mpc1 UTSW 17 8296878 missense possibly damaging 0.82
R3942:Mpc1 UTSW 17 8288588 splice site probably null
R4770:Mpc1 UTSW 17 8293545 intron probably benign
R6484:Mpc1 UTSW 17 8296956 missense possibly damaging 0.90
R7852:Mpc1 UTSW 17 8296908 missense probably damaging 0.99
R8090:Mpc1 UTSW 17 8296873 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTGTCCAATTTTAGCTCTGC -3'
(R):5'- CGCCCACTGATAATCTCTGGAG -3'

Sequencing Primer
(F):5'- GTCCAATTTTAGCTCTGCATTTTAC -3'
(R):5'- TTCTTCATGTCATTGATAGCAGC -3'
Posted On2016-07-06