Incidental Mutation 'R5188:Gpr151'
ID398026
Institutional Source Beutler Lab
Gene Symbol Gpr151
Ensembl Gene ENSMUSG00000042816
Gene NameG protein-coupled receptor 151
SynonymsPGR7, C130082O03Rik, GalRL
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location42578020-42579652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42578755 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 286 (M286T)
Ref Sequence ENSEMBL: ENSMUSP00000058887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000054738] [ENSMUST00000173642]
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054738
AA Change: M286T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058887
Gene: ENSMUSG00000042816
AA Change: M286T

DomainStartEndE-ValueType
Pfam:7tm_1 57 310 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184771
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the galanin receptor subfamily of G protein-coupled receptors. The encoded protein is found predominantly in the central nervous system. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Gpr151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Gpr151 APN 18 42578770 missense probably benign 0.03
IGL03167:Gpr151 APN 18 42578374 missense probably benign 0.06
R1561:Gpr151 UTSW 18 42579156 missense probably benign 0.42
R3875:Gpr151 UTSW 18 42578596 missense probably benign 0.02
R4294:Gpr151 UTSW 18 42578537 missense probably benign 0.00
R5431:Gpr151 UTSW 18 42578867 missense probably damaging 1.00
R5815:Gpr151 UTSW 18 42579385 missense probably benign 0.00
R6199:Gpr151 UTSW 18 42578554 missense probably benign 0.31
R6302:Gpr151 UTSW 18 42579394 missense probably damaging 1.00
R6891:Gpr151 UTSW 18 42578920 missense probably benign 0.15
R7180:Gpr151 UTSW 18 42578956 nonsense probably null
R8262:Gpr151 UTSW 18 42578372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGGTGATGGAGCCTTTC -3'
(R):5'- ATTTCTGGCGAGCTTATGACC -3'

Sequencing Primer
(F):5'- AAGGGCCTCTGTGTTTCCAGC -3'
(R):5'- CTGGCGAGCTTATGACCAATGTAAG -3'
Posted On2016-07-06