Incidental Mutation 'R5188:Ndufv1'
ID398027
Institutional Source Beutler Lab
Gene Symbol Ndufv1
Ensembl Gene ENSMUSG00000037916
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 1
Synonyms24 kDa (FP)
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4007497-4012806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4009988 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 37 (N37K)
Ref Sequence ENSEMBL: ENSMUSP00000123680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025806] [ENSMUST00000042497] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921] [ENSMUST00000155405]
Predicted Effect probably benign
Transcript: ENSMUST00000025806
SMART Domains Protein: ENSMUSP00000025806
Gene: ENSMUSG00000024871

DomainStartEndE-ValueType
C2 99 206 1.14e-10 SMART
low complexity region 231 243 N/A INTRINSIC
C2 259 373 5.14e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042497
AA Change: N116K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916
AA Change: N116K

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127016
Predicted Effect probably damaging
Transcript: ENSMUST00000128787
AA Change: N107K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916
AA Change: N107K

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129706
AA Change: C120S
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916
AA Change: C120S

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132747
Predicted Effect probably damaging
Transcript: ENSMUST00000133474
AA Change: N37K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916
AA Change: N37K

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134049
Predicted Effect possibly damaging
Transcript: ENSMUST00000134479
AA Change: N37K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916
AA Change: N37K

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136921
AA Change: N37K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916
AA Change: N37K

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149482
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The human ortholog of this protein has been characterized. It has consensus motifs for NADH, flavin mononucleotide, and iron-sulfur binding sites and participates in the oxidation of NADH as part of the dehydrogenase module of complex I. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Ctsw C T 19: 5,467,092 A71T probably damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Ndufv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Ndufv1 APN 19 4008803 missense probably benign 0.03
IGL02376:Ndufv1 APN 19 4007823 splice site probably null
R1929:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2270:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2271:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R3917:Ndufv1 UTSW 19 4010002 missense probably damaging 1.00
R4844:Ndufv1 UTSW 19 4012574 missense probably benign 0.00
R4875:Ndufv1 UTSW 19 4012653 splice site probably null
R5853:Ndufv1 UTSW 19 4008811 splice site probably null
R6614:Ndufv1 UTSW 19 4008749 missense probably benign 0.24
R7791:Ndufv1 UTSW 19 4011533 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGCCAGGAAAGACGAC -3'
(R):5'- TCCTGTCATCGGTGTGACAC -3'

Sequencing Primer
(F):5'- AGCCAGCGCTCATGTTC -3'
(R):5'- CTGTCATCGGTGTGACACAAAGAG -3'
Posted On2016-07-06