Incidental Mutation 'R5188:Ctsw'
ID398028
Institutional Source Beutler Lab
Gene Symbol Ctsw
Ensembl Gene ENSMUSG00000024910
Gene Namecathepsin W
Synonymslymphopain
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5188 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5465240-5468498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5467092 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 71 (A71T)
Ref Sequence ENSEMBL: ENSMUSP00000025844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025844] [ENSMUST00000025847] [ENSMUST00000225141]
Predicted Effect probably damaging
Transcript: ENSMUST00000025844
AA Change: A71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025844
Gene: ENSMUSG00000024910
AA Change: A71T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 40 97 2.21e-12 SMART
Pept_C1 126 357 1.58e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025847
SMART Domains Protein: ENSMUSP00000025847
Gene: ENSMUSG00000024911

DomainStartEndE-ValueType
Pfam:FIBP 3 363 7.6e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224944
Predicted Effect probably benign
Transcript: ENSMUST00000225141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226017
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of the encoded protein is upregulated following lymphocyte activation. Data from a human cell line suggests that the encoded enzyme may be important for viral entry into host cells. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants are fertile and healthy with normal cytotoxic lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 T A 1: 71,291,492 I1335F probably benign Het
Amigo3 C A 9: 108,054,683 A435E probably damaging Het
Atr T A 9: 95,921,725 N1871K probably benign Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Golgb1 A G 16: 36,918,465 T2389A probably benign Het
Gpr151 A G 18: 42,578,755 M286T probably benign Het
Katnbl1 T A 2: 112,410,154 I262N probably damaging Het
Lrp1 A G 10: 127,607,952 C149R probably damaging Het
Mpc1 A T 17: 8,296,383 probably benign Het
Ndufv1 A T 19: 4,009,988 N37K probably damaging Het
Olfr1046 T G 2: 86,217,177 S178R probably benign Het
Olfr150 T C 9: 39,737,235 V140A probably benign Het
Olfr313 C A 11: 58,817,320 T104K probably damaging Het
Olfr353 T A 2: 36,890,393 I152L probably benign Het
Pnpla7 C A 2: 24,997,300 P52Q probably benign Het
Prh1 A G 6: 132,571,707 Q59R unknown Het
Ren1 A G 1: 133,350,613 probably benign Het
Rnf148 T C 6: 23,654,140 T286A probably damaging Het
Sdk1 T C 5: 141,956,260 probably null Het
Srp72 T A 5: 76,974,751 S10T possibly damaging Het
Stk11 G T 10: 80,126,279 G215V probably damaging Het
Stk4 T C 2: 164,088,908 M143T possibly damaging Het
Supt20 T A 3: 54,710,428 S318T possibly damaging Het
Tchh G C 3: 93,446,679 R1142P unknown Het
Vipas39 G T 12: 87,254,247 R161S probably benign Het
Other mutations in Ctsw
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0845:Ctsw UTSW 19 5465461 unclassified probably benign
R1566:Ctsw UTSW 19 5465417 missense probably damaging 1.00
R2306:Ctsw UTSW 19 5466982 intron probably null
R5023:Ctsw UTSW 19 5466049 missense probably damaging 1.00
R5076:Ctsw UTSW 19 5468458 missense probably benign
R5101:Ctsw UTSW 19 5465675 missense probably benign 0.20
R5112:Ctsw UTSW 19 5466257 missense probably damaging 0.98
R6109:Ctsw UTSW 19 5467119 missense probably benign
R6436:Ctsw UTSW 19 5466294 missense possibly damaging 0.91
R6984:Ctsw UTSW 19 5466618 missense probably damaging 1.00
R6993:Ctsw UTSW 19 5465837 missense probably damaging 1.00
R7720:Ctsw UTSW 19 5467044 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATACAGTCTCTGGCCTGAGAG -3'
(R):5'- ATGTGGGGCTGGATAATCAC -3'

Sequencing Primer
(F):5'- CAGGCCACAGAAGTCATGTCTTG -3'
(R):5'- CTGGATAATCACTTTCTTGCAGGAG -3'
Posted On2016-07-06