Incidental Mutation 'R5190:Olfr1123'
ID398033
Institutional Source Beutler Lab
Gene Symbol Olfr1123
Ensembl Gene ENSMUSG00000043274
Gene Nameolfactory receptor 1123
SynonymsMOR264-17, GA_x6K02T2Q125-48917235-48918206
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87416635-87423211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87418843 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 263 (Y263C)
Ref Sequence ENSEMBL: ENSMUSP00000154459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054974] [ENSMUST00000216208]
Predicted Effect probably damaging
Transcript: ENSMUST00000054974
AA Change: Y265C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058786
Gene: ENSMUSG00000043274
AA Change: Y265C

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 4.4e-52 PFAM
Pfam:7tm_1 54 303 2.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214663
Predicted Effect probably damaging
Transcript: ENSMUST00000216208
AA Change: Y263C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Olfr1123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr1123 APN 2 87418566 missense possibly damaging 0.75
IGL01067:Olfr1123 APN 2 87418370 missense probably benign 0.00
IGL01526:Olfr1123 APN 2 87418975 missense probably damaging 0.99
IGL01580:Olfr1123 APN 2 87418536 missense probably benign 0.06
IGL01986:Olfr1123 APN 2 87418536 missense probably benign 0.00
IGL02503:Olfr1123 APN 2 87418292 missense probably benign 0.03
IGL02527:Olfr1123 APN 2 87418837 missense probably damaging 1.00
IGL02731:Olfr1123 APN 2 87418707 missense probably benign 0.00
IGL03215:Olfr1123 APN 2 87418068 missense probably benign 0.05
IGL03366:Olfr1123 APN 2 87418243 missense possibly damaging 0.88
R0645:Olfr1123 UTSW 2 87418268 nonsense probably null
R1857:Olfr1123 UTSW 2 87418648 missense probably damaging 1.00
R2175:Olfr1123 UTSW 2 87418156 missense probably damaging 1.00
R3691:Olfr1123 UTSW 2 87418170 missense probably benign 0.20
R4082:Olfr1123 UTSW 2 87418457 nonsense probably null
R4635:Olfr1123 UTSW 2 87418699 missense probably benign 0.05
R4877:Olfr1123 UTSW 2 87418563 nonsense probably null
R5253:Olfr1123 UTSW 2 87418668 missense possibly damaging 0.64
R6266:Olfr1123 UTSW 2 87419006 missense probably benign 0.01
R6784:Olfr1123 UTSW 2 87418452 missense probably benign 0.20
R6909:Olfr1123 UTSW 2 87418615 missense probably damaging 1.00
R7255:Olfr1123 UTSW 2 87418942 missense probably damaging 0.96
R8076:Olfr1123 UTSW 2 87418545 missense probably benign 0.00
R8116:Olfr1123 UTSW 2 87418737 missense probably damaging 1.00
R8315:Olfr1123 UTSW 2 87418651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTACTCAAACTTGCTTGTGG -3'
(R):5'- TTCAAGCATTTGCCTCACACTAG -3'

Sequencing Primer
(F):5'- TCTACGTAGTTGCGATGG -3'
(R):5'- GCCTCACACTAGTATCTTACTAAGG -3'
Posted On2016-07-06