Mutagenetix > Incidental Mutations

Incidental Mutation 'R5190:Baat'

398037

Institutional Source

Beutler Lab

Gene Symbol

Baat

Ensembl Gene

ENSMUSG00000039653

Gene Name

bile acid-Coenzyme A: amino acid N-acyltransferase

Synonyms

taurine N-acyltransferase, BAT

Accession Numbers

Genbank: NM_007519; MGI: 106642

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49489422-49506557 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49499652 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 218 (L218P)

Ref Sequence

ENSEMBL: ENSMUSP00000129603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043056
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: L218P

Domain	Start	End	E-Value	Type
Pfam:Bile_Hydr_Trans	13	145	1.7e-44	PFAM
low complexity region	149	162	N/A	INTRINSIC
Pfam:BAAT_C	206	414	8.1e-77	PFAM
Pfam:DLH	285	412	5.5e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166036
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: L218P

Domain	Start	End	E-Value	Type
Pfam:Bile_Hydr_Trans	14	144	5.1e-45	PFAM
low complexity region	149	162	N/A	INTRINSIC
Pfam:BAAT_C	206	414	1.2e-77	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
Dopey1	A	G	9: 86,487,304	I63M	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Fdxacb1	A	C	9: 50,772,087	H248P	possibly damaging	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
P3h2	A	G	16: 25,984,949	S356P	possibly damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Slitrk5	C	A	14: 111,679,420	Q159K	probably damaging	Het
Trim3	G	T	7: 105,619,509	N79K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in Baat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Baat	APN	4	49490352	missense	probably damaging	1.00
IGL01124:Baat	APN	4	49490391	missense	possibly damaging	0.82
IGL01327:Baat	APN	4	49490338	missense	probably damaging	1.00
IGL02394:Baat	APN	4	49489812	unclassified	probably benign
IGL03267:Baat	APN	4	49490050	missense	probably benign	0.00
R0085:Baat	UTSW	4	49490425	splice site	probably benign
R1467:Baat	UTSW	4	49503101	missense	probably benign
R1467:Baat	UTSW	4	49503101	missense	probably benign
R1720:Baat	UTSW	4	49490231	missense	probably benign
R2309:Baat	UTSW	4	49499718	missense	probably damaging	1.00
R2992:Baat	UTSW	4	49499675	nonsense	probably null
R4383:Baat	UTSW	4	49499731	missense	probably damaging	1.00
R4602:Baat	UTSW	4	49502727	missense	probably damaging	1.00
R5259:Baat	UTSW	4	49490070	missense	probably benign	0.08
R5456:Baat	UTSW	4	49502949	missense	possibly damaging	0.91
R5988:Baat	UTSW	4	49502871	missense	probably damaging	1.00
R6265:Baat	UTSW	4	49502836	missense	possibly damaging	0.94
R7091:Baat	UTSW	4	49499692	missense	probably benign	0.00
R7209:Baat	UTSW	4	49503065	missense	probably damaging	1.00
R7295:Baat	UTSW	4	49490275	missense	probably damaging	1.00
R7325:Baat	UTSW	4	49490213	missense	probably benign	0.07
R7805:Baat	UTSW	4	49490327	missense	probably benign	0.00
R7867:Baat	UTSW	4	49502925	missense	probably benign	0.44
R7956:Baat	UTSW	4	49490117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGGGAGTCTTGCTCTTGCTC -3'
(R):5'- TTCCAGGGGTCATTGACTTG -3'

Sequencing Primer
(F):5'- CTTGATGTGTGAGACTGAGTAACTAC -3'
(R):5'- CCAGGGGTCATTGACTTGTTTGG -3'

Posted On

2016-07-06