Incidental Mutation 'R5190:Baat'
ID398037
Institutional Source Beutler Lab
Gene Symbol Baat
Ensembl Gene ENSMUSG00000039653
Gene Namebile acid-Coenzyme A: amino acid N-acyltransferase
Synonymstaurine N-acyltransferase, BAT
Accession Numbers

Genbank: NM_007519; MGI: 106642

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49489422-49506557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49499652 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000129603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]
Predicted Effect probably damaging
Transcript: ENSMUST00000043056
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: L218P

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 13 145 1.7e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 8.1e-77 PFAM
Pfam:DLH 285 412 5.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166036
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: L218P

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 144 5.1e-45 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 1.2e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Baat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Baat APN 4 49490352 missense probably damaging 1.00
IGL01124:Baat APN 4 49490391 missense possibly damaging 0.82
IGL01327:Baat APN 4 49490338 missense probably damaging 1.00
IGL02394:Baat APN 4 49489812 unclassified probably benign
IGL03267:Baat APN 4 49490050 missense probably benign 0.00
R0085:Baat UTSW 4 49490425 splice site probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1720:Baat UTSW 4 49490231 missense probably benign
R2309:Baat UTSW 4 49499718 missense probably damaging 1.00
R2992:Baat UTSW 4 49499675 nonsense probably null
R4383:Baat UTSW 4 49499731 missense probably damaging 1.00
R4602:Baat UTSW 4 49502727 missense probably damaging 1.00
R5259:Baat UTSW 4 49490070 missense probably benign 0.08
R5456:Baat UTSW 4 49502949 missense possibly damaging 0.91
R5988:Baat UTSW 4 49502871 missense probably damaging 1.00
R6265:Baat UTSW 4 49502836 missense possibly damaging 0.94
R7091:Baat UTSW 4 49499692 missense probably benign 0.00
R7209:Baat UTSW 4 49503065 missense probably damaging 1.00
R7295:Baat UTSW 4 49490275 missense probably damaging 1.00
R7325:Baat UTSW 4 49490213 missense probably benign 0.07
R7805:Baat UTSW 4 49490327 missense probably benign 0.00
R7867:Baat UTSW 4 49502925 missense probably benign 0.44
R7956:Baat UTSW 4 49490117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGGAGTCTTGCTCTTGCTC -3'
(R):5'- TTCCAGGGGTCATTGACTTG -3'

Sequencing Primer
(F):5'- CTTGATGTGTGAGACTGAGTAACTAC -3'
(R):5'- CCAGGGGTCATTGACTTGTTTGG -3'
Posted On2016-07-06