Incidental Mutation 'R5190:Gnai1'
ID398039
Institutional Source Beutler Lab
Gene Symbol Gnai1
Ensembl Gene ENSMUSG00000057614
Gene Nameguanine nucleotide binding protein (G protein), alpha inhibiting 1
SynonymsGialpha1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location18265135-18360355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18291598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 109 (V109E)
Ref Sequence ENSEMBL: ENSMUSP00000074259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074694]
Predicted Effect probably benign
Transcript: ENSMUST00000074694
AA Change: V109E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074259
Gene: ENSMUSG00000057614
AA Change: V109E

DomainStartEndE-ValueType
G_alpha 13 353 5.13e-223 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit long term memory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Gnai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Gnai1 APN 5 18291619 missense probably benign 0.00
IGL00981:Gnai1 APN 5 18267047 missense probably benign 0.05
IGL01717:Gnai1 APN 5 18291461 critical splice donor site probably null
IGL01958:Gnai1 APN 5 18273570 missense probably damaging 1.00
R0238:Gnai1 UTSW 5 18273550 missense probably damaging 1.00
R0238:Gnai1 UTSW 5 18273550 missense probably damaging 1.00
R4828:Gnai1 UTSW 5 18291472 missense probably damaging 1.00
R4858:Gnai1 UTSW 5 18291598 missense probably benign
R5591:Gnai1 UTSW 5 18271846 missense probably benign 0.03
R6636:Gnai1 UTSW 5 18273474 missense probably damaging 1.00
R7326:Gnai1 UTSW 5 18289551 missense
R8184:Gnai1 UTSW 5 18291506 missense
Z1177:Gnai1 UTSW 5 18308552 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTCTTCATGATAGCTGACTTC -3'
(R):5'- ATCAAAGCCGTGCTGTTCTC -3'

Sequencing Primer
(F):5'- ATAGCTGACTTCTAAAGCTGTGGC -3'
(R):5'- TGGTTAGCAAACACTTCCTCAG -3'
Posted On2016-07-06