Incidental Mutation 'R5190:Fam216a'
ID398042
Institutional Source Beutler Lab
Gene Symbol Fam216a
Ensembl Gene ENSMUSG00000029463
Gene Namefamily with sequence similarity 216, member A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122364580-122372364 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 122367521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031419] [ENSMUST00000031419] [ENSMUST00000031419] [ENSMUST00000031420] [ENSMUST00000111729] [ENSMUST00000118765] [ENSMUST00000118830] [ENSMUST00000127608] [ENSMUST00000155671]
Predicted Effect probably null
Transcript: ENSMUST00000031419
SMART Domains Protein: ENSMUSP00000031419
Gene: ENSMUSG00000029463

DomainStartEndE-ValueType
Pfam:FAM216B 50 160 6e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031419
SMART Domains Protein: ENSMUSP00000031419
Gene: ENSMUSG00000029463

DomainStartEndE-ValueType
Pfam:FAM216B 50 160 6e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031419
SMART Domains Protein: ENSMUSP00000031419
Gene: ENSMUSG00000029463

DomainStartEndE-ValueType
Pfam:FAM216B 50 160 6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031420
SMART Domains Protein: ENSMUSP00000031420
Gene: ENSMUSG00000029464

DomainStartEndE-ValueType
Pfam:ATP_bind_1 8 254 5.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111729
SMART Domains Protein: ENSMUSP00000107358
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118765
SMART Domains Protein: ENSMUSP00000112579
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
PDB:1W24|A 1 65 7e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000118830
SMART Domains Protein: ENSMUSP00000113525
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 6 162 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127608
SMART Domains Protein: ENSMUSP00000143405
Gene: ENSMUSG00000029464

DomainStartEndE-ValueType
Pfam:ATP_bind_1 8 189 1.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155671
SMART Domains Protein: ENSMUSP00000121020
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 158 3.4e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Fam216a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01881:Fam216a APN 5 122367635 missense probably damaging 1.00
IGL02389:Fam216a APN 5 122367511 missense probably damaging 0.99
R0487:Fam216a UTSW 5 122370513 critical splice donor site probably null
R0690:Fam216a UTSW 5 122367646 missense probably damaging 1.00
R7084:Fam216a UTSW 5 122369560 missense probably benign 0.31
R7651:Fam216a UTSW 5 122367382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACAGACCCTTCTTTGTG -3'
(R):5'- TCTTTCAGCATCCAGAGCTC -3'

Sequencing Primer
(F):5'- TGTCTCAGGGGTCGCCAAAG -3'
(R):5'- CAGAAGCGTTACCTGTGCAG -3'
Posted On2016-07-06