Incidental Mutation 'R5190:Cand2'
ID398044
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5190 (G1)
Quality Score164
Status Not validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115789513 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 360 (A360S)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably damaging
Transcript: ENSMUST00000075995
AA Change: A360S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: A360S

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0534:Cand2 UTSW 6 115787236 missense probably damaging 0.96
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0662:Cand2 UTSW 6 115787210 missense probably benign 0.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0849:Cand2 UTSW 6 115792391 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5698:Cand2 UTSW 6 115791743 missense probably damaging 1.00
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6172:Cand2 UTSW 6 115791310 missense probably benign 0.00
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
R7520:Cand2 UTSW 6 115785251 nonsense probably null
R8183:Cand2 UTSW 6 115791918 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACAGGTGTTCACTAGGGTG -3'
(R):5'- CATATTGAGGTTTCTGCCAGTCTG -3'

Sequencing Primer
(F):5'- CCAGTGGGCTGAATACTGATCATC -3'
(R):5'- AGTCTGGGTGGGCTCCTC -3'
Posted On2016-07-06