Incidental Mutation 'R5190:Zfp296'
ID398046
Institutional Source Beutler Lab
Gene Symbol Zfp296
Ensembl Gene ENSMUSG00000011267
Gene Namezinc finger protein 296
Synonyms2210018A16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R5190 (G1)
Quality Score175
Status Not validated
Chromosome7
Chromosomal Location19577287-19580656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19577407 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000104093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051364] [ENSMUST00000086041] [ENSMUST00000108453] [ENSMUST00000117222] [ENSMUST00000119912] [ENSMUST00000122055] [ENSMUST00000122127] [ENSMUST00000151646] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068] [ENSMUST00000208826]
Predicted Effect probably benign
Transcript: ENSMUST00000051364
SMART Domains Protein: ENSMUSP00000055844
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086041
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108453
AA Change: V9A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104093
Gene: ENSMUSG00000011267
AA Change: V9A

DomainStartEndE-ValueType
ZnF_C2H2 138 161 5.07e0 SMART
ZnF_C2H2 212 234 2.05e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
low complexity region 281 295 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 360 382 1.95e-3 SMART
ZnF_C2H2 388 410 3.39e-3 SMART
ZnF_C2H2 418 441 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117222
SMART Domains Protein: ENSMUSP00000113266
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119912
SMART Domains Protein: ENSMUSP00000112742
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122055
SMART Domains Protein: ENSMUSP00000113583
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122127
SMART Domains Protein: ENSMUSP00000113709
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151646
SMART Domains Protein: ENSMUSP00000116207
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 81 7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect probably benign
Transcript: ENSMUST00000207907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208314
Predicted Effect probably benign
Transcript: ENSMUST00000208068
Predicted Effect probably benign
Transcript: ENSMUST00000208826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Zfp296
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Zfp296 APN 7 19577835 missense possibly damaging 0.85
IGL01098:Zfp296 APN 7 19577920 missense possibly damaging 0.72
R0359:Zfp296 UTSW 7 19579939 missense possibly damaging 0.68
R0510:Zfp296 UTSW 7 19577906 missense probably benign 0.01
R0707:Zfp296 UTSW 7 19579736 missense probably benign 0.00
R4931:Zfp296 UTSW 7 19579712 missense possibly damaging 0.73
R4932:Zfp296 UTSW 7 19579712 missense possibly damaging 0.73
R4933:Zfp296 UTSW 7 19579712 missense possibly damaging 0.73
R5974:Zfp296 UTSW 7 19577937 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGAGTTTGACCTCCGAGAC -3'
(R):5'- TTAGAACTCAGAGGCATCCGC -3'

Sequencing Primer
(F):5'- GAGACTGGCCCCGTAAAGAC -3'
(R):5'- CATCCGATATGGGCATGT -3'
Posted On2016-07-06