Incidental Mutation 'R5190:Olfr677'
ID398049
Institutional Source Beutler Lab
Gene Symbol Olfr677
Ensembl Gene ENSMUSG00000073914
Gene Nameolfactory receptor 677
SynonymsGA_x6K02T2PBJ9-7685262-7686200, MOR32-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105051372-105059006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105056453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 69 (S69L)
Ref Sequence ENSEMBL: ENSMUSP00000149888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098161] [ENSMUST00000213204]
Predicted Effect probably damaging
Transcript: ENSMUST00000098161
AA Change: S69L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095764
Gene: ENSMUSG00000073914
AA Change: S69L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 7.6e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 308 4.8e-6 PFAM
Pfam:7tm_1 43 293 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209491
Predicted Effect probably damaging
Transcript: ENSMUST00000213204
AA Change: S69L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Olfr677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Olfr677 APN 7 105056945 missense probably benign 0.10
IGL02351:Olfr677 APN 7 105056975 missense probably damaging 0.98
IGL02358:Olfr677 APN 7 105056975 missense probably damaging 0.98
IGL02696:Olfr677 APN 7 105056362 missense probably benign 0.39
R0089:Olfr677 UTSW 7 105057090 nonsense probably null
R0963:Olfr677 UTSW 7 105056972 missense probably damaging 0.98
R1157:Olfr677 UTSW 7 105056884 missense probably benign 0.01
R1719:Olfr677 UTSW 7 105056794 missense probably damaging 0.97
R1998:Olfr677 UTSW 7 105056905 missense probably benign 0.05
R2039:Olfr677 UTSW 7 105056390 missense possibly damaging 0.75
R2180:Olfr677 UTSW 7 105056885 missense probably benign 0.18
R2568:Olfr677 UTSW 7 105056671 missense probably benign 0.00
R4700:Olfr677 UTSW 7 105056276 missense possibly damaging 0.81
R4701:Olfr677 UTSW 7 105056879 missense probably damaging 1.00
R4803:Olfr677 UTSW 7 105056656 missense probably benign 0.39
R4888:Olfr677 UTSW 7 105056482 missense possibly damaging 0.95
R5121:Olfr677 UTSW 7 105056482 missense possibly damaging 0.95
R5593:Olfr677 UTSW 7 105056504 missense probably damaging 1.00
R6831:Olfr677 UTSW 7 105056879 missense possibly damaging 0.95
R6991:Olfr677 UTSW 7 105056564 missense probably damaging 1.00
R7387:Olfr677 UTSW 7 105057090 nonsense probably null
R7812:Olfr677 UTSW 7 105056687 missense possibly damaging 0.59
R7984:Olfr677 UTSW 7 105056432 missense probably damaging 0.98
R8199:Olfr677 UTSW 7 105056645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGACATTTGCTTGGAGAATG -3'
(R):5'- GCAACAAAGCGGTCATAAGC -3'

Sequencing Primer
(F):5'- GAATGTCTTCTATCAATAGCACCCAG -3'
(R):5'- TCATAAGCCATGACCACTAGC -3'
Posted On2016-07-06