Incidental Mutation 'R5190:Trim3'
ID 398050
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Name tripartite motif-containing 3
Synonyms BERP1, HAC1, Rnf22
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5190 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 105253670-105282778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105268716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 79 (N79K)
Ref Sequence ENSEMBL: ENSMUSP00000119910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
AlphaFold Q9R1R2
Predicted Effect probably damaging
Transcript: ENSMUST00000057525
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106789
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
AA Change: N79K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably damaging
Transcript: ENSMUST00000147044
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect probably damaging
Transcript: ENSMUST00000153371
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211532
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Abca7 T C 10: 79,835,427 (GRCm39) probably null Het
Abca8a C T 11: 109,980,735 (GRCm39) probably null Het
Ablim3 A G 18: 61,952,982 (GRCm39) Y361H probably benign Het
Acan C T 7: 78,748,289 (GRCm39) T1020I probably benign Het
Baat A G 4: 49,499,652 (GRCm39) L218P probably damaging Het
Bcl11b C A 12: 107,955,975 (GRCm39) C58F probably damaging Het
Cand2 G T 6: 115,766,474 (GRCm39) A360S probably damaging Het
Cdh2 A G 18: 16,783,372 (GRCm39) V62A possibly damaging Het
Cep44 C T 8: 56,985,831 (GRCm39) V354I probably benign Het
Col3a1 G A 1: 45,368,244 (GRCm39) R309Q unknown Het
Col3a1 G A 1: 45,383,967 (GRCm39) probably benign Het
Coq5 A G 5: 115,433,839 (GRCm39) probably null Het
Crtac1 A G 19: 42,322,347 (GRCm39) I131T possibly damaging Het
Decr1 C T 4: 15,924,270 (GRCm39) V217M probably damaging Het
Dnajc13 A G 9: 104,051,724 (GRCm39) V1706A probably benign Het
Dop1a A G 9: 86,369,357 (GRCm39) I63M probably damaging Het
F830045P16Rik T C 2: 129,314,635 (GRCm39) D214G probably benign Het
Fam216a T A 5: 122,505,584 (GRCm39) probably null Het
Fdxacb1 A C 9: 50,683,387 (GRCm39) H248P possibly damaging Het
Gnai1 A T 5: 18,496,596 (GRCm39) V109E probably benign Het
Helz2 A T 2: 180,872,550 (GRCm39) probably null Het
Itgam T C 7: 127,715,489 (GRCm39) probably null Het
Kcnh1 A G 1: 192,187,836 (GRCm39) S766G probably benign Het
Klra1 C A 6: 130,352,241 (GRCm39) C167F probably damaging Het
Krtap9-3 T A 11: 99,488,808 (GRCm39) T25S probably benign Het
Mapk6 T C 9: 75,295,626 (GRCm39) Y624C probably damaging Het
Or10ag2 A G 2: 87,249,187 (GRCm39) Y263C probably damaging Het
Or1ad8 T G 11: 50,898,381 (GRCm39) I194S probably damaging Het
Or2y1g T C 11: 49,171,209 (GRCm39) V78A probably damaging Het
Or52e4 C T 7: 104,705,660 (GRCm39) S69L probably damaging Het
Or9m2 T A 2: 87,821,107 (GRCm39) Y217* probably null Het
P3h2 A G 16: 25,803,699 (GRCm39) S356P possibly damaging Het
Pde12 C T 14: 26,387,532 (GRCm39) probably null Het
Rln3 T G 8: 84,769,866 (GRCm39) K94N probably damaging Het
Skint5 T C 4: 113,620,711 (GRCm39) I668V unknown Het
Slitrk5 C A 14: 111,916,852 (GRCm39) Q159K probably damaging Het
Tyw1 T A 5: 130,296,756 (GRCm39) C101* probably null Het
Ulk2 T C 11: 61,672,537 (GRCm39) T934A probably benign Het
Unc5b T C 10: 60,608,072 (GRCm39) Y687C probably benign Het
Vmn1r195 C T 13: 22,462,556 (GRCm39) R9* probably null Het
Zfc3h1 T G 10: 115,254,597 (GRCm39) L1397R probably damaging Het
Zfp296 T C 7: 19,311,332 (GRCm39) V9A probably benign Het
Zfp423 T A 8: 88,509,091 (GRCm39) S397C probably damaging Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105,266,676 (GRCm39) missense probably damaging 1.00
IGL01543:Trim3 APN 7 105,262,520 (GRCm39) missense probably damaging 1.00
IGL01573:Trim3 APN 7 105,274,700 (GRCm39) missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105,267,689 (GRCm39) splice site probably benign
IGL02407:Trim3 APN 7 105,262,218 (GRCm39) missense probably benign 0.44
IGL02868:Trim3 APN 7 105,262,239 (GRCm39) missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105,261,863 (GRCm39) missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105,267,417 (GRCm39) missense probably benign 0.08
R1013:Trim3 UTSW 7 105,267,102 (GRCm39) missense probably benign 0.10
R2296:Trim3 UTSW 7 105,262,481 (GRCm39) missense probably damaging 1.00
R3724:Trim3 UTSW 7 105,260,396 (GRCm39) missense probably damaging 1.00
R4028:Trim3 UTSW 7 105,267,452 (GRCm39) missense probably benign 0.04
R4347:Trim3 UTSW 7 105,268,594 (GRCm39) missense probably damaging 1.00
R4383:Trim3 UTSW 7 105,267,606 (GRCm39) missense probably damaging 1.00
R4475:Trim3 UTSW 7 105,267,009 (GRCm39) missense probably damaging 1.00
R4567:Trim3 UTSW 7 105,262,623 (GRCm39) missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105,267,047 (GRCm39) missense probably damaging 1.00
R4981:Trim3 UTSW 7 105,268,335 (GRCm39) missense probably damaging 0.99
R5053:Trim3 UTSW 7 105,266,968 (GRCm39) missense probably damaging 1.00
R5230:Trim3 UTSW 7 105,268,720 (GRCm39) missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105,268,276 (GRCm39) missense probably damaging 0.96
R5382:Trim3 UTSW 7 105,267,554 (GRCm39) missense probably benign 0.10
R5712:Trim3 UTSW 7 105,268,743 (GRCm39) missense probably damaging 0.99
R5725:Trim3 UTSW 7 105,266,947 (GRCm39) critical splice donor site probably null
R5915:Trim3 UTSW 7 105,267,182 (GRCm39) missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105,260,278 (GRCm39) missense probably damaging 0.98
R6073:Trim3 UTSW 7 105,266,746 (GRCm39) missense probably damaging 1.00
R6430:Trim3 UTSW 7 105,267,212 (GRCm39) missense probably benign 0.20
R6589:Trim3 UTSW 7 105,267,167 (GRCm39) missense probably damaging 1.00
R7044:Trim3 UTSW 7 105,267,421 (GRCm39) missense probably damaging 0.97
R7207:Trim3 UTSW 7 105,262,583 (GRCm39) missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105,267,007 (GRCm39) nonsense probably null
R7454:Trim3 UTSW 7 105,268,765 (GRCm39) missense probably damaging 1.00
R7459:Trim3 UTSW 7 105,267,015 (GRCm39) missense probably damaging 1.00
R8044:Trim3 UTSW 7 105,262,465 (GRCm39) synonymous silent
R8202:Trim3 UTSW 7 105,260,632 (GRCm39) missense possibly damaging 0.68
R9343:Trim3 UTSW 7 105,260,673 (GRCm39) missense probably benign 0.10
R9667:Trim3 UTSW 7 105,267,455 (GRCm39) missense possibly damaging 0.78
R9775:Trim3 UTSW 7 105,260,377 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCACACTACACTTCTTTG -3'
(R):5'- GGTTAAGCATCTATGAGGGACG -3'

Sequencing Primer
(F):5'- TTCACCCCTGCAGAGCC -3'
(R):5'- CATCTATGAGGGACGTTTTGCCAC -3'
Posted On 2016-07-06