Mutagenetix > Incidental Mutations

Incidental Mutation 'R5190:Trim3'

398050

Institutional Source

Beutler Lab

Gene Symbol

Trim3

Ensembl Gene

ENSMUSG00000036989

Gene Name

tripartite motif-containing 3

Synonyms

HAC1, Rnf22, BERP1

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105604463-105633571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 105619509 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 79 (N79K)

Ref Sequence

ENSEMBL: ENSMUSP00000119910 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057525
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: N79K

Domain	Start	End	E-Value	Type
RING	22	62	6.43e-8	SMART
BBOX	110	151	7.54e-14	SMART
BBC	158	284	2.55e-42	SMART
IG_FLMN	321	421	1.06e-31	SMART
Pfam:NHL	486	513	2.5e-9	PFAM
Pfam:NHL	533	560	1.9e-9	PFAM
Pfam:NHL	575	602	5.5e-8	PFAM
Pfam:NHL	622	649	1e-10	PFAM
Pfam:NHL	669	696	1.8e-12	PFAM
Pfam:NHL	713	740	1.9e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106789
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: N79K

Domain	Start	End	E-Value	Type
RING	22	62	6.43e-8	SMART
BBOX	110	151	7.54e-14	SMART
BBC	158	284	2.55e-42	SMART
IG_FLMN	321	421	1.06e-31	SMART
Pfam:NHL	486	513	1.8e-8	PFAM
Pfam:NHL	533	560	3.9e-10	PFAM
Pfam:NHL	575	602	2.3e-7	PFAM
Pfam:NHL	622	649	3.9e-10	PFAM
Pfam:NHL	669	696	2.2e-12	PFAM
Pfam:NHL	713	740	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106791
AA Change: N79K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: N79K

Domain	Start	End	E-Value	Type
RING	22	62	6.43e-8	SMART
BBOX	110	151	7.54e-14	SMART
BBC	158	284	2.55e-42	SMART
IG_FLMN	321	421	1.06e-31	SMART
Pfam:NHL	486	513	3.4e-8	PFAM
Pfam:NHL	533	560	7.6e-10	PFAM
Pfam:NHL	575	602	4.4e-7	PFAM
Pfam:NHL	622	649	7.6e-10	PFAM
Pfam:NHL	669	696	2.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140882

Predicted Effect

probably damaging
Transcript: ENSMUST00000147044
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: N79K

Domain	Start	End	E-Value	Type
RING	22	62	6.43e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150363

Predicted Effect

probably damaging
Transcript: ENSMUST00000153371
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989
AA Change: N79K

Domain	Start	End	E-Value	Type
RING	22	62	6.43e-8	SMART
BBOX	110	157	3.55e-10	SMART
Blast:BBC	164	199	9e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211532

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Baat	A	G	4: 49,499,652	L218P	probably damaging	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
Dopey1	A	G	9: 86,487,304	I63M	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Fdxacb1	A	C	9: 50,772,087	H248P	possibly damaging	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
P3h2	A	G	16: 25,984,949	S356P	possibly damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Slitrk5	C	A	14: 111,679,420	Q159K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in Trim3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trim3	APN	7	105617469	missense	probably damaging	1.00
IGL01543:Trim3	APN	7	105613313	missense	probably damaging	1.00
IGL01573:Trim3	APN	7	105625493	missense	possibly damaging	0.62
IGL01995:Trim3	APN	7	105618482	splice site	probably benign
IGL02407:Trim3	APN	7	105613011	missense	probably benign	0.44
IGL02868:Trim3	APN	7	105613032	missense	possibly damaging	0.82
IGL02837:Trim3	UTSW	7	105612656	missense	probably damaging	1.00
PIT4514001:Trim3	UTSW	7	105618210	missense	probably benign	0.08
R1013:Trim3	UTSW	7	105617895	missense	probably benign	0.10
R2296:Trim3	UTSW	7	105613274	missense	probably damaging	1.00
R3724:Trim3	UTSW	7	105611189	missense	probably damaging	1.00
R4028:Trim3	UTSW	7	105618245	missense	probably benign	0.04
R4347:Trim3	UTSW	7	105619387	missense	probably damaging	1.00
R4383:Trim3	UTSW	7	105618399	missense	probably damaging	1.00
R4475:Trim3	UTSW	7	105617802	missense	probably damaging	1.00
R4567:Trim3	UTSW	7	105613416	missense	possibly damaging	0.88
R4886:Trim3	UTSW	7	105617840	missense	probably damaging	1.00
R4981:Trim3	UTSW	7	105619128	missense	probably damaging	0.99
R5053:Trim3	UTSW	7	105617761	missense	probably damaging	1.00
R5230:Trim3	UTSW	7	105619513	missense	possibly damaging	0.81
R5364:Trim3	UTSW	7	105619069	missense	probably damaging	0.96
R5382:Trim3	UTSW	7	105618347	missense	probably benign	0.10
R5712:Trim3	UTSW	7	105619536	missense	probably damaging	0.99
R5725:Trim3	UTSW	7	105617740	critical splice donor site	probably null
R5915:Trim3	UTSW	7	105617975	missense	possibly damaging	0.82
R6058:Trim3	UTSW	7	105611071	missense	probably damaging	0.98
R6073:Trim3	UTSW	7	105617539	missense	probably damaging	1.00
R6430:Trim3	UTSW	7	105618005	missense	probably benign	0.20
R6589:Trim3	UTSW	7	105617960	missense	probably damaging	1.00
R7044:Trim3	UTSW	7	105618214	missense	probably damaging	0.97
R7207:Trim3	UTSW	7	105613376	missense	possibly damaging	0.87
R7326:Trim3	UTSW	7	105617800	nonsense	probably null
R7454:Trim3	UTSW	7	105619558	missense	probably damaging	1.00
R7459:Trim3	UTSW	7	105617808	missense	probably damaging	1.00
R8044:Trim3	UTSW	7	105613258	synonymous	silent
R8202:Trim3	UTSW	7	105611425	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ACAGCCACACTACACTTCTTTG -3'
(R):5'- GGTTAAGCATCTATGAGGGACG -3'

Sequencing Primer
(F):5'- TTCACCCCTGCAGAGCC -3'
(R):5'- CATCTATGAGGGACGTTTTGCCAC -3'

Posted On

2016-07-06