Incidental Mutation 'R5190:Trim3'
ID398050
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Nametripartite motif-containing 3
SynonymsHAC1, Rnf22, BERP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105604463-105633571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105619509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 79 (N79K)
Ref Sequence ENSEMBL: ENSMUSP00000119910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
Predicted Effect probably damaging
Transcript: ENSMUST00000057525
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106789
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
AA Change: N79K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably damaging
Transcript: ENSMUST00000147044
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect probably damaging
Transcript: ENSMUST00000153371
AA Change: N79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989
AA Change: N79K

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211532
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105617469 missense probably damaging 1.00
IGL01543:Trim3 APN 7 105613313 missense probably damaging 1.00
IGL01573:Trim3 APN 7 105625493 missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105618482 splice site probably benign
IGL02407:Trim3 APN 7 105613011 missense probably benign 0.44
IGL02868:Trim3 APN 7 105613032 missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105612656 missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105618210 missense probably benign 0.08
R1013:Trim3 UTSW 7 105617895 missense probably benign 0.10
R2296:Trim3 UTSW 7 105613274 missense probably damaging 1.00
R3724:Trim3 UTSW 7 105611189 missense probably damaging 1.00
R4028:Trim3 UTSW 7 105618245 missense probably benign 0.04
R4347:Trim3 UTSW 7 105619387 missense probably damaging 1.00
R4383:Trim3 UTSW 7 105618399 missense probably damaging 1.00
R4475:Trim3 UTSW 7 105617802 missense probably damaging 1.00
R4567:Trim3 UTSW 7 105613416 missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105617840 missense probably damaging 1.00
R4981:Trim3 UTSW 7 105619128 missense probably damaging 0.99
R5053:Trim3 UTSW 7 105617761 missense probably damaging 1.00
R5230:Trim3 UTSW 7 105619513 missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105619069 missense probably damaging 0.96
R5382:Trim3 UTSW 7 105618347 missense probably benign 0.10
R5712:Trim3 UTSW 7 105619536 missense probably damaging 0.99
R5725:Trim3 UTSW 7 105617740 critical splice donor site probably null
R5915:Trim3 UTSW 7 105617975 missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105611071 missense probably damaging 0.98
R6073:Trim3 UTSW 7 105617539 missense probably damaging 1.00
R6430:Trim3 UTSW 7 105618005 missense probably benign 0.20
R6589:Trim3 UTSW 7 105617960 missense probably damaging 1.00
R7044:Trim3 UTSW 7 105618214 missense probably damaging 0.97
R7207:Trim3 UTSW 7 105613376 missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105617800 nonsense probably null
R7454:Trim3 UTSW 7 105619558 missense probably damaging 1.00
R7459:Trim3 UTSW 7 105617808 missense probably damaging 1.00
R8044:Trim3 UTSW 7 105613258 synonymous silent
R8202:Trim3 UTSW 7 105611425 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACAGCCACACTACACTTCTTTG -3'
(R):5'- GGTTAAGCATCTATGAGGGACG -3'

Sequencing Primer
(F):5'- TTCACCCCTGCAGAGCC -3'
(R):5'- CATCTATGAGGGACGTTTTGCCAC -3'
Posted On2016-07-06