Incidental Mutation 'R5190:Itgam'
ID398051
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Nameintegrin alpha M
SynonymsMac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128062640-128118491 bp(+) (GRCm38)
Type of Mutationsplice site (2 bp from exon)
DNA Base Change (assembly) T to C at 128116317 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000106242] [ENSMUST00000120355] [ENSMUST00000120355]
Predicted Effect probably null
Transcript: ENSMUST00000064821
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064821
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106240
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106240
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106242
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106242
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120355
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120355
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126475
Predicted Effect probably benign
Transcript: ENSMUST00000134694
SMART Domains Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 39 82 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
adhesion UTSW 7 128101537 missense probably damaging 0.99
apparition UTSW 7 128112286 splice site probably null
attachment UTSW 7 128113033 missense probably damaging 1.00
Follower UTSW 7 128080264 missense probably damaging 1.00
invisible UTSW 7 128070703 splice site probably null
obscured UTSW 7 128081634 missense probably damaging 1.00
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2105:Itgam UTSW 7 128081712 missense probably damaging 1.00
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2656:Itgam UTSW 7 128116815 missense probably null 1.00
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 splice site probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6282:Itgam UTSW 7 128084942 missense probably benign 0.01
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGGTAAGAACATGGCG -3'
(R):5'- TAGACCTCACATACGACTCCTG -3'

Sequencing Primer
(F):5'- TAAGAACATGGCGGGGCTCC -3'
(R):5'- ATACGACTCCTGCCCTGGAAG -3'
Posted On2016-07-06