Incidental Mutation 'R5190:Rln3'
ID398053
Institutional Source Beutler Lab
Gene Symbol Rln3
Ensembl Gene ENSMUSG00000045232
Gene Namerelaxin 3
SynonymsM3
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5190 (G1)
Quality Score127
Status Not validated
Chromosome8
Chromosomal Location84042929-84045000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84043237 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 94 (K94N)
Ref Sequence ENSEMBL: ENSMUSP00000051392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000061923]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061923
AA Change: K94N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051392
Gene: ENSMUSG00000045232
AA Change: K94N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 31 140 5.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210790
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the relaxin family of insulin-like hormones that is expressed predominantly in the brain and plays a role in physiological processes such as stress, memory and appetite regulation. The encoded protein is a precursor that is proteolytically processed to generate a heterodimeric mature form consisting A and B chains interlinked by disulfide bonds. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal body weight regulation, actvity levels, social investigation and behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Rln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF020:Rln3 UTSW 8 84043302 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCTTGAACATCGCACAGC -3'
(R):5'- CTCGAGGGGATGAAATCAAACTC -3'

Sequencing Primer
(F):5'- TTGAACATCGCACAGCTGACAG -3'
(R):5'- GGGATGAAATCAAACTCAGAACCGC -3'
Posted On2016-07-06