Mutagenetix > Incidental Mutations

Incidental Mutation 'R5190:Fdxacb1'

398055

Institutional Source

Beutler Lab

Gene Symbol

Fdxacb1

Ensembl Gene

ENSMUSG00000037845

Gene Name

ferredoxin-fold anticodon binding domain containing 1

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50768236-50773348 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 50772087 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 248 (H248P)

Ref Sequence

ENSEMBL: ENSMUSP00000135658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000159576] [ENSMUST00000162073] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]

Predicted Effect

probably benign
Transcript: ENSMUST00000034561

SMART Domains

Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_22	60	482	3.5e-127	PFAM
low complexity region	598	611	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042391
AA Change: H450P

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845
AA Change: H450P

Domain	Start	End	E-Value	Type
Pfam:DUF2431	7	176	1.4e-44	PFAM
low complexity region	258	269	N/A	INTRINSIC
SCOP:d1jjca_	487	516	6e-4	SMART
FDX-ACB	528	622	5.88e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000042468

SMART Domains

Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

Domain	Start	End	E-Value	Type
Pfam:DUF1143	1	149	7.7e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159576

SMART Domains

Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_22	60	228	1e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162073

SMART Domains

Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_22	60	167	7.5e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162442

Predicted Effect

probably benign
Transcript: ENSMUST00000176145

SMART Domains

Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

Domain	Start	End	E-Value	Type
Pfam:DUF2431	7	115	4.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176160

Predicted Effect

probably benign
Transcript: ENSMUST00000176238

SMART Domains

Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

Domain	Start	End	E-Value	Type
Pfam:DUF1143	1	70	4.2e-47	PFAM
Pfam:DUF1143	68	126	5.3e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176335
AA Change: H248P

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845
AA Change: H248P

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1jjca_	285	314	3e-4	SMART
FDX-ACB	326	420	5.88e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176619

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176894

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177022

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177142

Predicted Effect

probably benign
Transcript: ENSMUST00000177384

Predicted Effect

probably benign
Transcript: ENSMUST00000177546

SMART Domains

Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

Domain	Start	End	E-Value	Type
Pfam:DUF1143	13	72	3.3e-39	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Baat	A	G	4: 49,499,652	L218P	probably damaging	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
Dopey1	A	G	9: 86,487,304	I63M	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
P3h2	A	G	16: 25,984,949	S356P	possibly damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Slitrk5	C	A	14: 111,679,420	Q159K	probably damaging	Het
Trim3	G	T	7: 105,619,509	N79K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in Fdxacb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02403:Fdxacb1	APN	9	50771563	missense	possibly damaging	0.75
IGL02828:Fdxacb1	APN	9	50771564	missense	possibly damaging	0.75
IGL02799:Fdxacb1	UTSW	9	50772596	missense	probably benign	0.01
R0755:Fdxacb1	UTSW	9	50771725	missense	possibly damaging	0.87
R1283:Fdxacb1	UTSW	9	50768694	missense	possibly damaging	0.79
R1395:Fdxacb1	UTSW	9	50772496	frame shift	probably null
R1991:Fdxacb1	UTSW	9	50771646	missense	probably benign	0.00
R2103:Fdxacb1	UTSW	9	50771646	missense	probably benign	0.00
R2273:Fdxacb1	UTSW	9	50772021	missense	probably benign	0.01
R2913:Fdxacb1	UTSW	9	50768399	missense	probably benign	0.05
R2914:Fdxacb1	UTSW	9	50768399	missense	probably benign	0.05
R4289:Fdxacb1	UTSW	9	50772579	missense	probably damaging	0.99
R4492:Fdxacb1	UTSW	9	50770247	missense	probably damaging	0.99
R4668:Fdxacb1	UTSW	9	50770260	missense	possibly damaging	0.74
R4742:Fdxacb1	UTSW	9	50768668	unclassified	probably benign
R4789:Fdxacb1	UTSW	9	50770118	missense	possibly damaging	0.84
R4935:Fdxacb1	UTSW	9	50771943	missense	probably benign	0.00
R5652:Fdxacb1	UTSW	9	50768405	missense	probably damaging	1.00
R6130:Fdxacb1	UTSW	9	50772602	nonsense	probably null
R7483:Fdxacb1	UTSW	9	50770151	missense	possibly damaging	0.89
R7487:Fdxacb1	UTSW	9	50770219	missense	possibly damaging	0.88
R7571:Fdxacb1	UTSW	9	50771793	missense	probably damaging	0.98
R8069:Fdxacb1	UTSW	9	50768835	missense	probably damaging	1.00
R8201:Fdxacb1	UTSW	9	50770155	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGATGCCAGCATTTCACGAG -3'
(R):5'- GGCAAATCTCTTCAGGAAACG -3'

Sequencing Primer
(F):5'- GCCAGCATTTCACGAGACTTTATTC -3'
(R):5'- CTTCAGGAAACGGTTATCAAAAGTCC -3'

Posted On

2016-07-06