Incidental Mutation 'R5190:Mapk6'
ID398056
Institutional Source Beutler Lab
Gene Symbol Mapk6
Ensembl Gene ENSMUSG00000042688
Gene Namemitogen-activated protein kinase 6
SynonymsMapk4, D130053K17Rik, ERK3, Prkm6, Mapk63, Prkm4, Erk3, 2610021I23Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R5190 (G1)
Quality Score114
Status Not validated
Chromosome9
Chromosomal Location75369062-75410005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75388344 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 624 (Y624C)
Ref Sequence ENSEMBL: ENSMUSP00000129024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049355] [ENSMUST00000168937]
Predicted Effect probably damaging
Transcript: ENSMUST00000049355
AA Change: Y624C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040315
Gene: ENSMUSG00000042688
AA Change: Y624C

DomainStartEndE-ValueType
S_TKc 20 316 8.02e-87 SMART
low complexity region 647 670 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168937
AA Change: Y624C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129024
Gene: ENSMUSG00000042688
AA Change: Y624C

DomainStartEndE-ValueType
S_TKc 20 316 8.02e-87 SMART
low complexity region 647 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174034
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show limited fetal growth, reduced serum IGF2 levels, pulmonary hypoplasia and early neonatal death. About 40% of newborns die of acute respiratory failure exhibiting delayed lung maturation, reduced sacculation, atelectasis, and impaired type II pneumocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Mapk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mapk6 APN 9 75388790 missense possibly damaging 0.79
IGL01843:Mapk6 APN 9 75390290 missense probably damaging 1.00
IGL03060:Mapk6 APN 9 75397802 missense probably damaging 0.98
PIT4651001:Mapk6 UTSW 9 75397587 missense possibly damaging 0.90
R0056:Mapk6 UTSW 9 75388816 missense possibly damaging 0.66
R0056:Mapk6 UTSW 9 75388816 missense possibly damaging 0.66
R0659:Mapk6 UTSW 9 75397962 missense probably damaging 0.99
R1673:Mapk6 UTSW 9 75395569 missense probably damaging 1.00
R3419:Mapk6 UTSW 9 75397757 missense probably damaging 1.00
R4798:Mapk6 UTSW 9 75388432 missense probably benign
R5117:Mapk6 UTSW 9 75397735 missense possibly damaging 0.56
R5521:Mapk6 UTSW 9 75393316 intron probably benign
R5579:Mapk6 UTSW 9 75388062 missense possibly damaging 0.63
R6792:Mapk6 UTSW 9 75395548 missense probably damaging 1.00
R7237:Mapk6 UTSW 9 75397613 missense probably damaging 1.00
RF013:Mapk6 UTSW 9 75388260 frame shift probably null
RF044:Mapk6 UTSW 9 75388260 frame shift probably null
RF057:Mapk6 UTSW 9 75388258 frame shift probably null
X0025:Mapk6 UTSW 9 75395508 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATAGCGGAAGGTGTCAAG -3'
(R):5'- GTCAGTCAGCCGAGAAAAGC -3'

Sequencing Primer
(F):5'- TCAAGGTGGCCTGGATGGAC -3'
(R):5'- CAAGAAAAGGGAAGGGCTAACC -3'
Posted On2016-07-06