Mutagenetix > Incidental Mutations

Incidental Mutation 'R5190:Dopey1'

398057

Institutional Source

Beutler Lab

Gene Symbol

Dopey1

Ensembl Gene

ENSMUSG00000034973

Gene Name

dopey family member 1

Synonyms

B130005I07Rik, D9Ertd809e

Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86467154-86555923 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86487304 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 63 (I63M)

Ref Sequence

ENSEMBL: ENSMUSP00000140740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034987
AA Change: I63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: I63M

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	300	1e-117	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185919
AA Change: I63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: I63M

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	1.9e-106	PFAM
low complexity region	629	647	N/A	INTRINSIC
low complexity region	959	971	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
low complexity region	1294	1316	N/A	INTRINSIC
low complexity region	1333	1342	N/A	INTRINSIC
low complexity region	1360	1371	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186290

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187607

Predicted Effect

probably damaging
Transcript: ENSMUST00000188675
AA Change: I63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: I63M

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	3e-106	PFAM
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190906

Predicted Effect

probably damaging
Transcript: ENSMUST00000190957
AA Change: I63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: I63M

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	305	1.3e-108	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Baat	A	G	4: 49,499,652	L218P	probably damaging	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Fdxacb1	A	C	9: 50,772,087	H248P	possibly damaging	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
P3h2	A	G	16: 25,984,949	S356P	possibly damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Slitrk5	C	A	14: 111,679,420	Q159K	probably damaging	Het
Trim3	G	T	7: 105,619,509	N79K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in Dopey1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dopey1	APN	9	86551679	missense	possibly damaging	0.57
IGL00427:Dopey1	APN	9	86521500	missense	probably benign	0.09
IGL00427:Dopey1	APN	9	86521498	missense	possibly damaging	0.93
IGL00427:Dopey1	APN	9	86521499	missense	probably damaging	0.96
IGL00577:Dopey1	APN	9	86520946	missense	probably damaging	1.00
IGL00741:Dopey1	APN	9	86522806	missense	possibly damaging	0.50
IGL00959:Dopey1	APN	9	86487431	missense	probably damaging	1.00
IGL01339:Dopey1	APN	9	86551677	missense	possibly damaging	0.90
IGL01608:Dopey1	APN	9	86507561	missense	probably benign	0.23
IGL01760:Dopey1	APN	9	86519923	missense	probably benign
IGL01788:Dopey1	APN	9	86531719	missense	probably benign	0.03
IGL01844:Dopey1	APN	9	86514085	missense	probably damaging	1.00
IGL01923:Dopey1	APN	9	86522867	missense	probably damaging	1.00
IGL02036:Dopey1	APN	9	86531765	missense	probably benign	0.18
IGL02308:Dopey1	APN	9	86520088	missense	probably damaging	0.98
IGL02494:Dopey1	APN	9	86526818	missense	probably damaging	1.00
IGL02698:Dopey1	APN	9	86524359	splice site	probably benign
IGL02731:Dopey1	APN	9	86487381	missense	probably damaging	1.00
IGL02821:Dopey1	APN	9	86520156	missense	probably benign
IGL02952:Dopey1	APN	9	86532922	splice site	probably benign
IGL03071:Dopey1	APN	9	86489615	missense	possibly damaging	0.91
IGL03271:Dopey1	APN	9	86504222	nonsense	probably null
IGL03344:Dopey1	APN	9	86536144	missense	probably damaging	1.00
Beg	UTSW	9	86548172	nonsense	probably null
groak	UTSW	9	86521657	missense	probably damaging	1.00
R0055:Dopey1	UTSW	9	86512652	missense	probably benign	0.08
R0285:Dopey1	UTSW	9	86512639	missense	probably damaging	1.00
R0415:Dopey1	UTSW	9	86506502	missense	probably damaging	1.00
R0427:Dopey1	UTSW	9	86507532	missense	probably damaging	1.00
R0514:Dopey1	UTSW	9	86520734	missense	probably damaging	1.00
R0538:Dopey1	UTSW	9	86485497	missense	probably damaging	1.00
R1118:Dopey1	UTSW	9	86515406	missense	probably damaging	1.00
R1158:Dopey1	UTSW	9	86485556	missense	probably damaging	1.00
R1272:Dopey1	UTSW	9	86521424	missense	probably damaging	1.00
R1448:Dopey1	UTSW	9	86542732	splice site	probably null
R1584:Dopey1	UTSW	9	86548172	nonsense	probably null
R1601:Dopey1	UTSW	9	86536250	missense	probably damaging	0.99
R1674:Dopey1	UTSW	9	86536160	missense	probably damaging	0.98
R1706:Dopey1	UTSW	9	86554080	missense	possibly damaging	0.92
R1856:Dopey1	UTSW	9	86492004	missense	probably damaging	0.99
R1926:Dopey1	UTSW	9	86523019	missense	probably damaging	1.00
R1929:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2029:Dopey1	UTSW	9	86521365	missense	probably damaging	1.00
R2125:Dopey1	UTSW	9	86521046	missense	probably damaging	1.00
R2206:Dopey1	UTSW	9	86521599	missense	probably benign	0.00
R2271:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2312:Dopey1	UTSW	9	86521442	nonsense	probably null
R2379:Dopey1	UTSW	9	86521085	missense	probably damaging	1.00
R2507:Dopey1	UTSW	9	86513117	missense	probably damaging	1.00
R3737:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R3804:Dopey1	UTSW	9	86520995	missense	probably damaging	1.00
R3916:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R3921:Dopey1	UTSW	9	86520271	missense	probably benign	0.06
R4035:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R4392:Dopey1	UTSW	9	86503143	intron	probably benign
R4404:Dopey1	UTSW	9	86522813	nonsense	probably null
R4513:Dopey1	UTSW	9	86520559	missense	probably benign	0.39
R4624:Dopey1	UTSW	9	86521525	missense	probably damaging	1.00
R4659:Dopey1	UTSW	9	86502032	intron	probably benign
R4910:Dopey1	UTSW	9	86492061	missense	probably damaging	1.00
R4919:Dopey1	UTSW	9	86520056	missense	possibly damaging	0.47
R5061:Dopey1	UTSW	9	86503108	splice site	probably benign
R5079:Dopey1	UTSW	9	86487421	missense	probably damaging	1.00
R5118:Dopey1	UTSW	9	86506259	missense	probably damaging	1.00
R5169:Dopey1	UTSW	9	86533021	missense	probably damaging	1.00
R5176:Dopey1	UTSW	9	86521815	missense	probably damaging	1.00
R5256:Dopey1	UTSW	9	86515328	missense	probably damaging	1.00
R5346:Dopey1	UTSW	9	86520782	missense	probably damaging	1.00
R5484:Dopey1	UTSW	9	86545288	missense	probably damaging	1.00
R5501:Dopey1	UTSW	9	86507730	missense	probably benign	0.04
R5554:Dopey1	UTSW	9	86521657	missense	probably damaging	1.00
R5707:Dopey1	UTSW	9	86502997	missense	possibly damaging	0.95
R5826:Dopey1	UTSW	9	86507570	missense	possibly damaging	0.94
R5921:Dopey1	UTSW	9	86501922	missense	probably damaging	1.00
R5934:Dopey1	UTSW	9	86542442	nonsense	probably null
R5936:Dopey1	UTSW	9	86536512	nonsense	probably null
R6046:Dopey1	UTSW	9	86515343	missense	probably damaging	1.00
R6053:Dopey1	UTSW	9	86515294	missense	possibly damaging	0.95
R6072:Dopey1	UTSW	9	86507697	missense	probably benign	0.00
R6104:Dopey1	UTSW	9	86520807	missense	possibly damaging	0.86
R6125:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R6299:Dopey1	UTSW	9	86504212	missense	probably damaging	1.00
R6930:Dopey1	UTSW	9	86531772	critical splice donor site	probably null
R6949:Dopey1	UTSW	9	86500860	missense	probably damaging	1.00
R6979:Dopey1	UTSW	9	86521642	missense	possibly damaging	0.77
R7035:Dopey1	UTSW	9	86524302	missense	possibly damaging	0.85
R7069:Dopey1	UTSW	9	86550169	critical splice donor site	probably null
R7101:Dopey1	UTSW	9	86507669	missense	probably benign
R7202:Dopey1	UTSW	9	86504167	splice site	probably null
R7222:Dopey1	UTSW	9	86522876	critical splice donor site	probably null
R7233:Dopey1	UTSW	9	86521696	missense	probably benign	0.00
R7236:Dopey1	UTSW	9	86515378	missense	probably damaging	1.00
R7252:Dopey1	UTSW	9	86500821	missense	probably damaging	1.00
R7268:Dopey1	UTSW	9	86512777	nonsense	probably null
R7353:Dopey1	UTSW	9	86512859	missense	probably damaging	0.99
R7481:Dopey1	UTSW	9	86535932	missense	probably damaging	1.00
R7498:Dopey1	UTSW	9	86494411	missense	possibly damaging	0.95
R7507:Dopey1	UTSW	9	86535949	missense	probably benign	0.01
R7525:Dopey1	UTSW	9	86506290	missense	probably damaging	1.00
R7539:Dopey1	UTSW	9	86521573	missense	probably benign	0.03
R7751:Dopey1	UTSW	9	86507730	missense	probably benign	0.00
R7753:Dopey1	UTSW	9	86489702	missense	possibly damaging	0.52
R7839:Dopey1	UTSW	9	86542765	nonsense	probably null
R7868:Dopey1	UTSW	9	86501984	critical splice donor site	probably null
R8061:Dopey1	UTSW	9	86521193	missense	possibly damaging	0.95
R8067:Dopey1	UTSW	9	86518339	missense	probably benign	0.00
R8156:Dopey1	UTSW	9	86494457	missense	probably damaging	1.00
R8196:Dopey1	UTSW	9	86523098	missense	probably benign	0.12
R8223:Dopey1	UTSW	9	86518292	missense	probably damaging	1.00
R8267:Dopey1	UTSW	9	86514001	missense	possibly damaging	0.81
R8276:Dopey1	UTSW	9	86517039	missense	probably benign
R8306:Dopey1	UTSW	9	86520206	missense	possibly damaging	0.94
R8353:Dopey1	UTSW	9	86521586	missense	probably damaging	0.97
R8362:Dopey1	UTSW	9	86513888	missense	probably benign	0.02
R8403:Dopey1	UTSW	9	86500872	missense	probably damaging	1.00
RF004:Dopey1	UTSW	9	86554191	missense	probably benign
X0019:Dopey1	UTSW	9	86506227	missense	probably damaging	1.00
X0019:Dopey1	UTSW	9	86531750	missense	probably damaging	0.98
ZE80:Dopey1	UTSW	9	86500842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTTGACAGTCAGTTTCTTT -3'
(R):5'- AACACAATTTGAGAAAGGCTTTACT -3'

Sequencing Primer
(F):5'- TGACAGTCAGTTTCTTTCTCTCTC -3'
(R):5'- ACTAGTTATGTAGACCAGGCTGCC -3'

Posted On

2016-07-06