Mutagenetix > Incidental Mutations

Incidental Mutation 'R5190:Slitrk5'

398072

Institutional Source

Beutler Lab

Gene Symbol

Slitrk5

Ensembl Gene

ENSMUSG00000033214

Gene Name

SLIT and NTRK-like family, member 5

Synonyms

2610019D03Rik

Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene?

Possibly essential (E-score: 0.565) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111675097-111683141 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 111679420 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 159 (Q159K)

Ref Sequence

ENSEMBL: ENSMUSP00000041499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042767
AA Change: Q159K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: Q159K

Domain	Start	End	E-Value	Type
Blast:LRRNT	47	85	3e-18	BLAST
low complexity region	86	96	N/A	INTRINSIC
LRR	108	127	2.76e2	SMART
LRR_TYP	128	151	1.67e-2	SMART
LRR	152	175	2.67e-1	SMART
LRR	176	199	1.08e-1	SMART
LRR	202	223	7.38e1	SMART
LRRCT	235	285	2.13e-5	SMART
low complexity region	308	323	N/A	INTRINSIC
LRRNT	373	410	9.53e-2	SMART
LRR	433	455	1.45e1	SMART
LRR_TYP	456	479	4.94e-5	SMART
LRR_TYP	480	503	7.78e-3	SMART
LRR_TYP	504	527	2.43e-4	SMART
LRR	528	551	1.86e2	SMART
LRRCT	563	613	3.59e-3	SMART
low complexity region	618	632	N/A	INTRINSIC
transmembrane domain	666	688	N/A	INTRINSIC
low complexity region	794	816	N/A	INTRINSIC
low complexity region	818	823	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000227891

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Baat	A	G	4: 49,499,652	L218P	probably damaging	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
Dopey1	A	G	9: 86,487,304	I63M	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Fdxacb1	A	C	9: 50,772,087	H248P	possibly damaging	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
P3h2	A	G	16: 25,984,949	S356P	possibly damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Trim3	G	T	7: 105,619,509	N79K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in Slitrk5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Slitrk5	APN	14	111680665	missense	probably benign	0.05
IGL01624:Slitrk5	APN	14	111681094	missense	probably damaging	1.00
IGL01680:Slitrk5	APN	14	111679000	missense	probably benign	0.23
IGL03234:Slitrk5	APN	14	111679285	missense	probably benign	0.00
P0019:Slitrk5	UTSW	14	111680594	missense	possibly damaging	0.88
R0323:Slitrk5	UTSW	14	111681623	missense	probably damaging	0.99
R0334:Slitrk5	UTSW	14	111680824	missense	probably benign
R0392:Slitrk5	UTSW	14	111679033	missense	probably benign	0.06
R0659:Slitrk5	UTSW	14	111680689	missense	probably benign	0.00
R1344:Slitrk5	UTSW	14	111680389	missense	probably benign	0.04
R1754:Slitrk5	UTSW	14	111680519	missense	probably damaging	1.00
R1983:Slitrk5	UTSW	14	111680389	missense	probably benign	0.04
R2070:Slitrk5	UTSW	14	111680189	missense	probably damaging	0.99
R2071:Slitrk5	UTSW	14	111680189	missense	probably damaging	0.99
R3001:Slitrk5	UTSW	14	111679582	missense	probably damaging	1.00
R3002:Slitrk5	UTSW	14	111679582	missense	probably damaging	1.00
R3003:Slitrk5	UTSW	14	111679582	missense	probably damaging	1.00
R3885:Slitrk5	UTSW	14	111679797	nonsense	probably null
R3886:Slitrk5	UTSW	14	111679797	nonsense	probably null
R3888:Slitrk5	UTSW	14	111679797	nonsense	probably null
R4962:Slitrk5	UTSW	14	111681247	missense	probably benign	0.02
R4999:Slitrk5	UTSW	14	111680216	missense	probably damaging	0.99
R5036:Slitrk5	UTSW	14	111680884	missense	possibly damaging	0.87
R5237:Slitrk5	UTSW	14	111681686	missense	possibly damaging	0.94
R5669:Slitrk5	UTSW	14	111681623	missense	probably damaging	0.99
R5793:Slitrk5	UTSW	14	111679913	missense	probably damaging	1.00
R5839:Slitrk5	UTSW	14	111679598	missense	probably benign	0.00
R6083:Slitrk5	UTSW	14	111681725	missense	probably benign	0.01
R6224:Slitrk5	UTSW	14	111679816	unclassified	probably benign
R6225:Slitrk5	UTSW	14	111679816	unclassified	probably benign
R6230:Slitrk5	UTSW	14	111679816	unclassified	probably benign
R6337:Slitrk5	UTSW	14	111680252	missense	probably damaging	0.96
R6666:Slitrk5	UTSW	14	111680102	missense	probably damaging	0.96
R6818:Slitrk5	UTSW	14	111680294	missense	probably benign	0.32
R6895:Slitrk5	UTSW	14	111681653	missense	probably damaging	1.00
R7094:Slitrk5	UTSW	14	111680836	missense	probably benign	0.02
R7385:Slitrk5	UTSW	14	111680699	missense	probably benign	0.32
R8532:Slitrk5	UTSW	14	111679477	missense	probably benign
Z1177:Slitrk5	UTSW	14	111679853	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- ACCTCTTGTTGTCTGGAAACC -3'
(R):5'- CACATAGGGCAGAAGTTTCAGC -3'

Sequencing Primer
(F):5'- TGTCTGGAAACCTTCTGAGCCG -3'
(R):5'- GCAGAAGTTTCAGCCTGTTC -3'

Posted On

2016-07-06