Incidental Mutation 'R5190:P3h2'
ID398073
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Nameprolyl 3-hydroxylase 2
SynonymsLeprel1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location25959288-26105784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25984949 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 356 (S356P)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039990
AA Change: S356P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: S356P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161878
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25992798 missense probably damaging 1.00
IGL01012:P3h2 APN 16 25987248 missense probably damaging 0.98
IGL02393:P3h2 APN 16 25992825 missense probably damaging 1.00
IGL02436:P3h2 APN 16 25997200 missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25984999 missense probably benign 0.01
R0319:P3h2 UTSW 16 25970931 missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25969950 missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25997248 missense probably benign
R1290:P3h2 UTSW 16 25987203 missense probably damaging 0.99
R1300:P3h2 UTSW 16 25997236 nonsense probably null
R1467:P3h2 UTSW 16 25965868 splice site probably benign
R1643:P3h2 UTSW 16 25972291 missense probably benign 0.00
R1645:P3h2 UTSW 16 25997232 missense probably damaging 1.00
R1761:P3h2 UTSW 16 25985050 missense probably damaging 0.96
R4227:P3h2 UTSW 16 26105453 missense probably benign
R4273:P3h2 UTSW 16 26105221 missense probably benign 0.00
R4409:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4410:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4653:P3h2 UTSW 16 26105277 missense probably damaging 0.98
R4968:P3h2 UTSW 16 25992662 critical splice donor site probably null
R6113:P3h2 UTSW 16 25981153 missense probably benign 0.01
R6225:P3h2 UTSW 16 25965743 missense probably damaging 0.97
R6838:P3h2 UTSW 16 26105284 missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25992745 missense probably damaging 1.00
R7089:P3h2 UTSW 16 25965809 missense probably damaging 1.00
R7445:P3h2 UTSW 16 25985065 missense probably damaging 0.96
R7753:P3h2 UTSW 16 25970937 missense probably damaging 1.00
R8166:P3h2 UTSW 16 25992822 missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25992718 missense probably damaging 0.98
R8442:P3h2 UTSW 16 25987205 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTAGGCAACAGGTTTGTCAC -3'
(R):5'- GGCAAATCTGGCTGATTCAAATG -3'

Sequencing Primer
(F):5'- GCAACAGGTTTGTCACAAGATTGTG -3'
(R):5'- CTGGCTGATTCAAATGTGGCAAC -3'
Posted On2016-07-06