Mutagenetix > Incidental Mutation

Incidental Mutation 'R5190:P3h2'

398073

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5190 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25984949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 356 (S356P)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039990
AA Change: S356P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: S356P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160067

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161878

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca7	T	C	10: 79,999,593		probably null	Het
Abca8a	C	T	11: 110,089,909		probably null	Het
Ablim3	A	G	18: 61,819,911	Y361H	probably benign	Het
Acan	C	T	7: 79,098,541	T1020I	probably benign	Het
Baat	A	G	4: 49,499,652	L218P	probably damaging	Het
Bcl11b	C	A	12: 107,989,716	C58F	probably damaging	Het
Cand2	G	T	6: 115,789,513	A360S	probably damaging	Het
Cdh2	A	G	18: 16,650,315	V62A	possibly damaging	Het
Cep44	C	T	8: 56,532,796	V354I	probably benign	Het
Col3a1	G	A	1: 45,329,084	R309Q	unknown	Het
Col3a1	G	A	1: 45,344,807		probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crtac1	A	G	19: 42,333,908	I131T	possibly damaging	Het
Decr1	C	T	4: 15,924,270	V217M	probably damaging	Het
Dnajc13	A	G	9: 104,174,525	V1706A	probably benign	Het
Dopey1	A	G	9: 86,487,304	I63M	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,715	D214G	probably benign	Het
Fam216a	T	A	5: 122,367,521		probably null	Het
Fdxacb1	A	C	9: 50,772,087	H248P	possibly damaging	Het
Gnai1	A	T	5: 18,291,598	V109E	probably benign	Het
Helz2	A	T	2: 181,230,757		probably null	Het
Itgam	T	C	7: 128,116,317		probably null	Het
Kcnh1	A	G	1: 192,505,528	S766G	probably benign	Het
Klra1	C	A	6: 130,375,278	C167F	probably damaging	Het
Krtap9-3	T	A	11: 99,597,982	T25S	probably benign	Het
Mapk6	T	C	9: 75,388,344	Y624C	probably damaging	Het
Olfr1123	A	G	2: 87,418,843	Y263C	probably damaging	Het
Olfr1158	T	A	2: 87,990,763	Y217*	probably null	Het
Olfr1393	T	C	11: 49,280,382	V78A	probably damaging	Het
Olfr51	T	G	11: 51,007,554	I194S	probably damaging	Het
Olfr677	C	T	7: 105,056,453	S69L	probably damaging	Het
Pde12	C	T	14: 26,666,377		probably null	Het
Rln3	T	G	8: 84,043,237	K94N	probably damaging	Het
Skint5	T	C	4: 113,763,514	I668V	unknown	Het
Slitrk5	C	A	14: 111,679,420	Q159K	probably damaging	Het
Trim3	G	T	7: 105,619,509	N79K	probably damaging	Het
Tyw1	T	A	5: 130,267,915	C101*	probably null	Het
Ulk2	T	C	11: 61,781,711	T934A	probably benign	Het
Unc5b	T	C	10: 60,772,293	Y687C	probably benign	Het
Vmn1r195	C	T	13: 22,278,386	R9*	probably null	Het
Zfc3h1	T	G	10: 115,418,692	L1397R	probably damaging	Het
Zfp296	T	C	7: 19,577,407	V9A	probably benign	Het
Zfp423	T	A	8: 87,782,463	S397C	probably damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTAGGCAACAGGTTTGTCAC -3'
(R):5'- GGCAAATCTGGCTGATTCAAATG -3'

Sequencing Primer
(F):5'- GCAACAGGTTTGTCACAAGATTGTG -3'
(R):5'- CTGGCTGATTCAAATGTGGCAAC -3'

Posted On

2016-07-06