Incidental Mutation 'R5190:Ablim3'
ID398077
Institutional Source Beutler Lab
Gene Symbol Ablim3
Ensembl Gene ENSMUSG00000032735
Gene Nameactin binding LIM protein family, member 3
SynonymsD930036B08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61799395-61911852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61819911 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 361 (Y361H)
Ref Sequence ENSEMBL: ENSMUSP00000125836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049378] [ENSMUST00000166783]
Predicted Effect probably benign
Transcript: ENSMUST00000049378
AA Change: Y361H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041243
Gene: ENSMUSG00000032735
AA Change: Y361H

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166783
AA Change: Y361H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125836
Gene: ENSMUSG00000032735
AA Change: Y361H

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-binding LIM (abLIM) family of proteins. These proteins are characterized by an N-terminal LIM domain and a C-terminal dematin-like domain. The encoded protein interacts with actin filaments and may be a component of adherens junctions in several cell types. A variant of this gene may be associated with pain sensitivity in male human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Ablim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ablim3 APN 18 61849406 missense possibly damaging 0.83
IGL00954:Ablim3 APN 18 61839685 splice site probably benign
IGL01012:Ablim3 APN 18 61839701 missense possibly damaging 0.91
IGL01402:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01404:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01609:Ablim3 APN 18 61822021 missense probably benign 0.05
IGL01710:Ablim3 APN 18 61871574 missense probably damaging 1.00
IGL01775:Ablim3 APN 18 61816918 splice site probably benign
IGL02967:Ablim3 APN 18 61826503 nonsense probably null
IGL03409:Ablim3 APN 18 61845851 missense probably damaging 1.00
R0143:Ablim3 UTSW 18 61855217 missense probably benign 0.20
R0601:Ablim3 UTSW 18 61849370 missense probably benign 0.19
R1067:Ablim3 UTSW 18 61823947 splice site probably benign
R1642:Ablim3 UTSW 18 61814311 missense probably benign 0.26
R1851:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R1852:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R2072:Ablim3 UTSW 18 61857088 missense possibly damaging 0.74
R2763:Ablim3 UTSW 18 61813544 nonsense probably null
R4865:Ablim3 UTSW 18 61805086 missense probably damaging 1.00
R5353:Ablim3 UTSW 18 61801399 missense probably damaging 1.00
R5442:Ablim3 UTSW 18 61857225 splice site probably null
R5835:Ablim3 UTSW 18 61823922 missense probably damaging 1.00
R6547:Ablim3 UTSW 18 61823929 missense probably benign 0.01
R7231:Ablim3 UTSW 18 61805064 critical splice donor site probably null
R7386:Ablim3 UTSW 18 61821994 missense probably damaging 1.00
R7404:Ablim3 UTSW 18 61822028 missense probably damaging 0.99
R7529:Ablim3 UTSW 18 61821968 missense probably benign
X0028:Ablim3 UTSW 18 61805112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCCCACAGACACTATGTG -3'
(R):5'- GAAGCCTAAGAATTCGTTCCCATC -3'

Sequencing Primer
(F):5'- AGACACTATGTGACCCCATTGTC -3'
(R):5'- CATCCTCCTCAGGTTGTGTGTG -3'
Posted On2016-07-06