Incidental Mutation 'R5190:Crtac1'
ID398082
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Namecartilage acidic protein 1
SynonymsLotus, Crtac1B, 2810454P21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42283037-42431783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42333908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 131 (I131T)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048630
AA Change: I131T

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Klra1 C A 6: 130,375,278 C167F probably damaging Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42323794 missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42284213 missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42414121 missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42333911 missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42287944 missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42334053 missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42323732 missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42283567 missense unknown
R2281:Crtac1 UTSW 19 42283567 missense unknown
R3508:Crtac1 UTSW 19 42304741 missense probably benign 0.09
R3923:Crtac1 UTSW 19 42333947 missense probably damaging 1.00
R4072:Crtac1 UTSW 19 42304707 missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42323801 missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42414131 missense probably benign
R4965:Crtac1 UTSW 19 42318740 missense probably damaging 1.00
R5579:Crtac1 UTSW 19 42304806 missense probably damaging 1.00
R5595:Crtac1 UTSW 19 42413951 missense probably benign 0.08
R5739:Crtac1 UTSW 19 42302173 missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42309190 splice site probably null
R5936:Crtac1 UTSW 19 42323837 missense probably damaging 1.00
R6149:Crtac1 UTSW 19 42283609 missense unknown
R6193:Crtac1 UTSW 19 42323797 missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42318735 missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42287926 missense probably benign
R7726:Crtac1 UTSW 19 42302251 nonsense probably null
R7991:Crtac1 UTSW 19 42333960 missense probably benign 0.24
R8046:Crtac1 UTSW 19 42309053 splice site probably benign
R8071:Crtac1 UTSW 19 42297800 missense probably damaging 1.00
R8350:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
R8450:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
X0018:Crtac1 UTSW 19 42309114 missense probably damaging 1.00
Z1176:Crtac1 UTSW 19 42287926 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATTACAGGAGATGAAGGGTC -3'
(R):5'- AATGGACTCTGAGCTGGGTG -3'

Sequencing Primer
(F):5'- GTCAACCTGGGGTCTCTGTC -3'
(R):5'- CTCTGAGCTGGGTGGAGCAAG -3'
Posted On2016-07-06