Incidental Mutation 'R5233:Pcdh10'
ID398083
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5233 (G1)
Quality Score117
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45384191 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 928 (R928S)
Ref Sequence ENSEMBL: ENSMUSP00000131600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: R928S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: R928S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: R928S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: R928S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: R928S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: R928S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193252
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.1165 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCAAGAGTCTGCAGCACAC -3'
(R):5'- GCATGGTGTTTAGATTCTAGAGTAC -3'

Sequencing Primer
(F):5'- AGAGTCTGCAGCACACATTAG -3'
(R):5'- TCTAGAGTACAGTTCTAACCTCAAC -3'
Posted On2016-07-06