Incidental Mutation 'R5233:Csn3'
ID398094
Institutional Source Beutler Lab
Gene Symbol Csn3
Ensembl Gene ENSMUSG00000001622
Gene Namecasein kappa
SynonymsCSN10, Csnk
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87925579-87932665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87929835 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 67 (P67S)
Ref Sequence ENSEMBL: ENSMUSP00000108896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001667] [ENSMUST00000113267] [ENSMUST00000113271]
Predicted Effect probably benign
Transcript: ENSMUST00000001667
AA Change: P67S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001667
Gene: ENSMUSG00000001622
AA Change: P67S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 180 2.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113267
AA Change: P67S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108892
Gene: ENSMUSG00000001622
AA Change: P67S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113271
AA Change: P67S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108896
Gene: ENSMUSG00000001622
AA Change: P67S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Meta Mutation Damage Score 0.2316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display lactation failure and abnormal milk composition, but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Csn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Csn3 APN 5 87930157 missense unknown
IGL02153:Csn3 APN 5 87930097 missense possibly damaging 0.80
IGL02936:Csn3 APN 5 87930133 missense possibly damaging 0.93
R0617:Csn3 UTSW 5 87929871 missense probably benign 0.18
R1502:Csn3 UTSW 5 87930124 missense probably damaging 0.98
R2329:Csn3 UTSW 5 87930003 missense possibly damaging 0.95
R3710:Csn3 UTSW 5 87930023 missense possibly damaging 0.63
R4514:Csn3 UTSW 5 87930138 missense unknown
R5079:Csn3 UTSW 5 87929767 missense possibly damaging 0.92
R5573:Csn3 UTSW 5 87930051 missense probably benign
R5913:Csn3 UTSW 5 87927611 missense probably damaging 0.99
R7175:Csn3 UTSW 5 87929727 missense probably damaging 0.98
R7577:Csn3 UTSW 5 87929962 missense not run
Predicted Primers PCR Primer
(F):5'- CACTGCATTATTTCAAAAGCTGCTG -3'
(R):5'- CCATGGTAGGAACTGGTGTG -3'

Sequencing Primer
(F):5'- CAAAAGCTGCTGAAGTTGTTTTG -3'
(R):5'- TGGTAGGAACTGGTGTGGACAC -3'
Posted On2016-07-06