Incidental Mutation 'R0453:Rhpn1'
ID39812
Institutional Source Beutler Lab
Gene Symbol Rhpn1
Ensembl Gene ENSMUSG00000022580
Gene Namerhophilin, Rho GTPase binding protein 1
SynonymsGrbp, Rhophilin
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0453 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75704280-75715485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75713579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 576 (S576P)
Ref Sequence ENSEMBL: ENSMUSP00000023244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023244] [ENSMUST00000121137] [ENSMUST00000149407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023244
AA Change: S576P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023244
Gene: ENSMUSG00000022580
AA Change: S576P

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 498 4.31e-147 SMART
PDZ 508 578 9.27e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121137
AA Change: S594P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113042
Gene: ENSMUSG00000022580
AA Change: S594P

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 516 1.64e-161 SMART
PDZ 526 596 9.27e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143056
Predicted Effect probably benign
Transcript: ENSMUST00000149407
SMART Domains Protein: ENSMUSP00000116837
Gene: ENSMUSG00000022580

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 449 7.17e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229843
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Rhpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Rhpn1 APN 15 75711886 missense probably damaging 0.99
IGL02211:Rhpn1 APN 15 75711056 missense possibly damaging 0.94
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0324:Rhpn1 UTSW 15 75711588 missense probably damaging 0.99
R0426:Rhpn1 UTSW 15 75711872 missense possibly damaging 0.71
R0893:Rhpn1 UTSW 15 75711654 missense probably damaging 1.00
R1051:Rhpn1 UTSW 15 75712392 missense probably damaging 0.99
R1571:Rhpn1 UTSW 15 75714118 missense possibly damaging 0.93
R1906:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R1907:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R2110:Rhpn1 UTSW 15 75713234 missense probably damaging 1.00
R2153:Rhpn1 UTSW 15 75704394 start codon destroyed probably null 0.00
R3943:Rhpn1 UTSW 15 75711806 missense probably damaging 0.97
R4030:Rhpn1 UTSW 15 75710557 missense probably damaging 1.00
R4552:Rhpn1 UTSW 15 75714119 missense probably benign 0.00
R5015:Rhpn1 UTSW 15 75708241 missense probably damaging 1.00
R5103:Rhpn1 UTSW 15 75714215 missense possibly damaging 0.83
R5121:Rhpn1 UTSW 15 75709260 missense probably damaging 1.00
R5337:Rhpn1 UTSW 15 75708205 missense probably benign
R7324:Rhpn1 UTSW 15 75704397 missense possibly damaging 0.89
R7596:Rhpn1 UTSW 15 75712313 missense probably benign 0.00
R7808:Rhpn1 UTSW 15 75713450 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTTTCAACCAAGAACCGATGGCAG -3'
(R):5'- TATGGAGGCACCATCAGAGGTGAC -3'

Sequencing Primer
(F):5'- TCCTAGAGGACCGCTAGATACTG -3'
(R):5'- CATCAGAGGTGACCACTGC -3'
Posted On2013-05-23