Incidental Mutation 'R5191:Limch1'
ID398132
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene NameLIM and calponin homology domains 1
Synonyms3732412D22Rik
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5191 (G1)
Quality Score166
Status Validated
Chromosome5
Chromosomal Location66745827-67057158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67027561 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 631 (L631P)
Ref Sequence ENSEMBL: ENSMUSP00000043163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242]
Predicted Effect probably damaging
Transcript: ENSMUST00000038188
AA Change: L631P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: L631P

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101164
AA Change: L787P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: L787P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117601
AA Change: L628P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: L628P

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118242
AA Change: L798P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: L798P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000119854
AA Change: L503P
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: L503P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201322
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 66953679 missense probably damaging 0.99
IGL00644:Limch1 APN 5 67016552 missense probably benign 0.01
IGL00705:Limch1 APN 5 66993153 nonsense probably null
IGL01154:Limch1 APN 5 66745958 nonsense probably null 0.00
IGL01865:Limch1 APN 5 66974580 nonsense probably null
IGL02529:Limch1 APN 5 67002613 missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67034194 missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67002558 missense possibly damaging 0.92
IGL03396:Limch1 APN 5 66953673 missense probably damaging 1.00
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0114:Limch1 UTSW 5 67036084 intron probably benign
R0129:Limch1 UTSW 5 66959590 missense probably damaging 0.96
R0193:Limch1 UTSW 5 67027539 missense probably damaging 1.00
R0194:Limch1 UTSW 5 66999273 missense probably benign 0.05
R0367:Limch1 UTSW 5 66857954 critical splice donor site probably null
R0558:Limch1 UTSW 5 66969155 missense probably damaging 1.00
R0927:Limch1 UTSW 5 66997233 missense probably damaging 1.00
R1190:Limch1 UTSW 5 66969197 missense probably damaging 1.00
R1316:Limch1 UTSW 5 66999243 missense probably damaging 1.00
R1469:Limch1 UTSW 5 66881980 splice site probably benign
R1647:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1648:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1944:Limch1 UTSW 5 66999099 missense probably damaging 1.00
R2103:Limch1 UTSW 5 66998729 missense probably benign 0.05
R2126:Limch1 UTSW 5 67029760 missense probably damaging 1.00
R2248:Limch1 UTSW 5 67044399 missense probably damaging 1.00
R2415:Limch1 UTSW 5 66974634 missense probably damaging 1.00
R3762:Limch1 UTSW 5 67028840 missense probably damaging 1.00
R3797:Limch1 UTSW 5 66969079 missense probably damaging 1.00
R4659:Limch1 UTSW 5 67027557 missense probably damaging 1.00
R4773:Limch1 UTSW 5 67027507 missense probably damaging 0.99
R4876:Limch1 UTSW 5 66881927 missense possibly damaging 0.64
R5062:Limch1 UTSW 5 66969235 missense probably damaging 1.00
R5202:Limch1 UTSW 5 66993173 missense probably damaging 1.00
R5335:Limch1 UTSW 5 66881957 missense probably damaging 1.00
R5436:Limch1 UTSW 5 66974566 missense possibly damaging 0.72
R5994:Limch1 UTSW 5 66974622 missense probably damaging 1.00
R6049:Limch1 UTSW 5 67030860 missense probably benign 0.32
R6228:Limch1 UTSW 5 67016502 missense probably damaging 1.00
R6547:Limch1 UTSW 5 67028774 missense probably damaging 1.00
R6600:Limch1 UTSW 5 66745938 missense probably benign
R6888:Limch1 UTSW 5 67021926 missense probably benign 0.21
R7111:Limch1 UTSW 5 67025176 intron probably null
R7132:Limch1 UTSW 5 66953685 missense probably damaging 1.00
R7144:Limch1 UTSW 5 67017658 missense probably benign 0.10
R7302:Limch1 UTSW 5 66959599 missense probably benign 0.02
R7341:Limch1 UTSW 5 67034202 missense probably benign 0.06
R7491:Limch1 UTSW 5 67054237 missense probably damaging 0.99
X0022:Limch1 UTSW 5 67021952 missense probably benign 0.00
X0027:Limch1 UTSW 5 67002620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGCCACCAAAGAGGAC -3'
(R):5'- GGAAGAATCAGGCCCAAGACTC -3'

Sequencing Primer
(F):5'- TGCCACCAAAGAGGACATTTAAATG -3'
(R):5'- AAGACTCCGCTGCCTGCAC -3'
Posted On2016-07-06