Incidental Mutation 'R5233:Mmp15'
ID398133
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95371068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 502 (V502A)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect probably benign
Transcript: ENSMUST00000034243
AA Change: V502A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: V502A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCAAGCAGACAGGTGAGC -3'
(R):5'- TCATGCTGGAACATGGCAC -3'

Sequencing Primer
(F):5'- TTCCCTTAAAGGAAGAGGCTCTAGC -3'
(R):5'- TGGCACAGTTAGGTCCCC -3'
Posted On2016-07-06