Incidental Mutation 'R5233:Myo9a'
ID398139
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59910617 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2322 (N2322K)
Ref Sequence ENSEMBL: ENSMUSP00000117432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127933
Predicted Effect probably damaging
Transcript: ENSMUST00000128341
AA Change: N2251K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: N2251K

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130497
Predicted Effect probably damaging
Transcript: ENSMUST00000135298
AA Change: N2322K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: N2322K

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136740
AA Change: N2322K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: N2322K

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
R7473:Myo9a UTSW 9 59895244 missense probably benign 0.31
R7723:Myo9a UTSW 9 59779858 missense probably damaging 1.00
R7823:Myo9a UTSW 9 59811950 missense probably damaging 1.00
R7824:Myo9a UTSW 9 59860109 missense probably damaging 1.00
RF018:Myo9a UTSW 9 59869586 missense probably benign 0.00
RF019:Myo9a UTSW 9 59921772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCTCATAAAATAAAGGATGCTTC -3'
(R):5'- TCCACATTAAATGTCCTCTGTACAC -3'

Sequencing Primer
(F):5'- CCTTCATCCCAAAACTGTCTAGG -3'
(R):5'- TGAGAAGCTCCTCTGGGCATAAC -3'
Posted On2016-07-06