Incidental Mutation 'R5233:Rfx6'
ID398145
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Nameregulatory factor X, 6
SynonymsRfxdc1, 4930572O07Rik
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51677756-51730432 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 51712091 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
Predicted Effect probably null
Transcript: ENSMUST00000050455
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: Y58*

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122922
AA Change: Y322*
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: Y322*

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably benign
Transcript: ENSMUST00000219364
Predicted Effect probably null
Transcript: ENSMUST00000219771
AA Change: Y109*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2495:Rfx6 UTSW 10 51726675 splice site probably benign
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51726880 missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6876:Rfx6 UTSW 10 51719991 missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7574:Rfx6 UTSW 10 51681818 missense probably benign 0.17
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAGTTGACTGAATGCTTC -3'
(R):5'- TGTTCCCTGAGAATTTAGATGCC -3'

Sequencing Primer
(F):5'- GAGTTGACTGAATGCTTCTCTATGAC -3'
(R):5'- CCCTGAGAATTTAGATGCCATATC -3'
Posted On2016-07-06