Incidental Mutation 'R5233:Rfx6'
ID 398145
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Name regulatory factor X, 6
Synonyms 4930572O07Rik, Rfxdc1
MMRRC Submission 042805-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5233 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 51553856-51606525 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 51588187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
AlphaFold Q8C7R7
Predicted Effect probably null
Transcript: ENSMUST00000050455
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: Y58*

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122922
AA Change: Y322*
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: Y322*

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably benign
Transcript: ENSMUST00000219364
Predicted Effect probably null
Transcript: ENSMUST00000219771
AA Change: Y109*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,301,801 (GRCm39) noncoding transcript Het
Aadat A G 8: 60,979,656 (GRCm39) I173V probably benign Het
Acsl6 G A 11: 54,216,432 (GRCm39) V200I possibly damaging Het
Alms1 T A 6: 85,633,353 (GRCm39) probably null Het
Arhgef17 A T 7: 100,530,576 (GRCm39) D1403E possibly damaging Het
Atp10b A G 11: 43,121,387 (GRCm39) T1017A probably benign Het
Capg C T 6: 72,532,509 (GRCm39) R25C probably damaging Het
Cd22 A G 7: 30,576,959 (GRCm39) I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,739,690 (GRCm39) probably benign Het
Ciita A T 16: 10,327,265 (GRCm39) I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 (GRCm39) V943A possibly damaging Het
Coq2 G A 5: 100,805,698 (GRCm39) H313Y possibly damaging Het
Csn3 C T 5: 88,077,694 (GRCm39) P67S probably benign Het
Csrnp3 A G 2: 65,852,684 (GRCm39) T359A possibly damaging Het
Cttnbp2nl A G 3: 104,912,357 (GRCm39) L509P probably damaging Het
Dclk3 A G 9: 111,297,749 (GRCm39) D431G probably benign Het
Dtx3l A T 16: 35,753,608 (GRCm39) C333S possibly damaging Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Fam171a1 G C 2: 3,179,390 (GRCm39) G72A probably damaging Het
Fbxw17 T C 13: 50,586,390 (GRCm39) probably benign Het
Fry A G 5: 150,393,185 (GRCm39) D605G possibly damaging Het
Fyn T C 10: 39,405,936 (GRCm39) F240S probably benign Het
Gcfc2 T C 6: 81,930,271 (GRCm39) L646P probably damaging Het
Gm5087 C T 14: 13,158,788 (GRCm38) noncoding transcript Het
Got2 T A 8: 96,602,477 (GRCm39) N91I probably benign Het
Hspa4 C T 11: 53,177,802 (GRCm39) V103I possibly damaging Het
Itgad A G 7: 127,792,600 (GRCm39) probably null Het
Krt33a A G 11: 99,904,961 (GRCm39) S182P probably damaging Het
Mcph1 T C 8: 18,721,254 (GRCm39) I694T probably damaging Het
Mmp15 T C 8: 96,097,696 (GRCm39) V502A probably benign Het
Mov10l1 T C 15: 88,867,235 (GRCm39) V23A probably benign Het
Myo9a T A 9: 59,817,900 (GRCm39) N2322K probably damaging Het
Ndst4 A G 3: 125,503,766 (GRCm39) Y11C probably damaging Het
Nell1 T C 7: 49,826,062 (GRCm39) F199S probably damaging Het
Nup210 C T 6: 91,003,951 (GRCm39) V646M probably damaging Het
Nup98 A T 7: 101,845,029 (GRCm39) S13R unknown Het
Nxf1 T C 19: 8,741,293 (GRCm39) I54T possibly damaging Het
Or8b38 A G 9: 37,973,446 (GRCm39) T277A probably damaging Het
Pcdh10 C A 3: 45,338,626 (GRCm39) R928S probably damaging Het
Pou3f3 A G 1: 42,737,438 (GRCm39) N378S probably benign Het
Rorc T A 3: 94,304,632 (GRCm39) V339D probably benign Het
Scin T A 12: 40,127,558 (GRCm39) I411F probably benign Het
Serpind1 A G 16: 17,154,758 (GRCm39) Y195C probably damaging Het
Tas2r117 T C 6: 132,780,585 (GRCm39) V241A possibly damaging Het
Tet3 T A 6: 83,363,045 (GRCm39) E709V probably damaging Het
Trbc1 T A 6: 41,515,383 (GRCm39) probably benign Het
Vmn1r212 C A 13: 23,067,304 (GRCm39) G343V unknown Het
Vmn2r42 T A 7: 8,197,837 (GRCm39) K261* probably null Het
Xrcc5 T A 1: 72,379,209 (GRCm39) L438Q probably damaging Het
Zfp142 T C 1: 74,624,608 (GRCm39) N72S probably damaging Het
Zfp292 A T 4: 34,809,755 (GRCm39) S1096R probably damaging Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51,557,982 (GRCm39) missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51,554,501 (GRCm39) missense probably benign 0.16
IGL01639:Rfx6 APN 10 51,592,002 (GRCm39) nonsense probably null
IGL01721:Rfx6 APN 10 51,599,173 (GRCm39) missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51,597,675 (GRCm39) missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51,602,952 (GRCm39) missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51,554,108 (GRCm39) missense probably benign
IGL02479:Rfx6 APN 10 51,554,424 (GRCm39) missense probably benign 0.07
IGL02592:Rfx6 APN 10 51,592,119 (GRCm39) missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51,592,122 (GRCm39) missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51,599,942 (GRCm39) missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51,599,217 (GRCm39) nonsense probably null
IGL03263:Rfx6 APN 10 51,601,903 (GRCm39) missense probably benign 0.00
IGL03373:Rfx6 APN 10 51,596,096 (GRCm39) missense probably damaging 0.99
bulky UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R0060:Rfx6 UTSW 10 51,553,936 (GRCm39) missense probably benign 0.00
R0433:Rfx6 UTSW 10 51,596,124 (GRCm39) missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51,569,833 (GRCm39) missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51,554,498 (GRCm39) missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51,599,221 (GRCm39) critical splice donor site probably null
R2017:Rfx6 UTSW 10 51,597,700 (GRCm39) missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51,596,153 (GRCm39) critical splice donor site probably null
R2044:Rfx6 UTSW 10 51,594,222 (GRCm39) missense probably benign 0.16
R2495:Rfx6 UTSW 10 51,602,771 (GRCm39) splice site probably benign
R2655:Rfx6 UTSW 10 51,569,873 (GRCm39) splice site probably benign
R2912:Rfx6 UTSW 10 51,594,226 (GRCm39) missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51,602,816 (GRCm39) missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51,602,842 (GRCm39) missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51,599,880 (GRCm39) missense probably benign 0.16
R4791:Rfx6 UTSW 10 51,596,040 (GRCm39) splice site probably null
R4945:Rfx6 UTSW 10 51,602,947 (GRCm39) nonsense probably null
R5223:Rfx6 UTSW 10 51,554,092 (GRCm39) nonsense probably null
R5448:Rfx6 UTSW 10 51,559,733 (GRCm39) missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51,599,157 (GRCm39) missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51,602,976 (GRCm39) missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51,601,964 (GRCm39) missense probably benign 0.00
R5949:Rfx6 UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R6001:Rfx6 UTSW 10 51,594,307 (GRCm39) splice site probably null
R6003:Rfx6 UTSW 10 51,584,683 (GRCm39) missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51,587,962 (GRCm39) missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51,601,586 (GRCm39) missense probably benign 0.02
R6876:Rfx6 UTSW 10 51,596,087 (GRCm39) missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51,592,135 (GRCm39) missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51,599,949 (GRCm39) missense probably benign 0.00
R7130:Rfx6 UTSW 10 51,554,476 (GRCm39) nonsense probably null
R7574:Rfx6 UTSW 10 51,557,914 (GRCm39) missense probably benign 0.17
R7845:Rfx6 UTSW 10 51,554,122 (GRCm39) missense probably benign 0.05
R8188:Rfx6 UTSW 10 51,594,292 (GRCm39) missense probably benign 0.05
R8338:Rfx6 UTSW 10 51,594,190 (GRCm39) missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51,601,501 (GRCm39) missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51,557,968 (GRCm39) missense probably damaging 1.00
R8982:Rfx6 UTSW 10 51,599,915 (GRCm39) missense probably benign 0.14
R9104:Rfx6 UTSW 10 51,599,106 (GRCm39) missense probably damaging 1.00
R9154:Rfx6 UTSW 10 51,597,600 (GRCm39) missense probably benign 0.01
R9188:Rfx6 UTSW 10 51,594,263 (GRCm39) missense probably benign 0.04
R9388:Rfx6 UTSW 10 51,554,117 (GRCm39) missense possibly damaging 0.60
V8831:Rfx6 UTSW 10 51,594,304 (GRCm39) critical splice donor site probably null
X0023:Rfx6 UTSW 10 51,554,507 (GRCm39) missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51,601,927 (GRCm39) nonsense probably null
Z1176:Rfx6 UTSW 10 51,594,189 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGAGTTGACTGAATGCTTC -3'
(R):5'- TGTTCCCTGAGAATTTAGATGCC -3'

Sequencing Primer
(F):5'- GAGTTGACTGAATGCTTCTCTATGAC -3'
(R):5'- CCCTGAGAATTTAGATGCCATATC -3'
Posted On 2016-07-06