Mutagenetix > Incidental Mutations

Incidental Mutation 'R5233:Rfx6'

398145

Institutional Source

Beutler Lab

Gene Symbol

Rfx6

Ensembl Gene

ENSMUSG00000019900

Gene Name

regulatory factor X, 6

Synonyms

Rfxdc1, 4930572O07Rik

MMRRC Submission

042805-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5233 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51677756-51730432 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 51712091 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 109 (Y109*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]

Predicted Effect

probably null
Transcript: ENSMUST00000050455
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: Y58*

Domain	Start	End	E-Value	Type
Blast:HisKA	91	153	1e-7	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000122922
AA Change: Y322*

SMART Domains

Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: Y322*

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	120	198	1.9e-33	PFAM
Blast:HisKA	355	417	2e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217662

Predicted Effect

probably benign
Transcript: ENSMUST00000219364

Predicted Effect

probably null
Transcript: ENSMUST00000219771
AA Change: Y109*

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030619P08Rik	T	A	15: 75,429,952		noncoding transcript	Het
Aadat	A	G	8: 60,526,622	I173V	probably benign	Het
Acsl6	G	A	11: 54,325,606	V200I	possibly damaging	Het
Alms1	T	A	6: 85,656,371		probably null	Het
Arhgef17	A	T	7: 100,881,369	D1403E	possibly damaging	Het
Atp10b	A	G	11: 43,230,560	T1017A	probably benign	Het
Capg	C	T	6: 72,555,526	R25C	probably damaging	Het
Cd22	A	G	7: 30,877,534	I116T	probably damaging	Het
Cep135	AGTCTGCCTTTGG	A	5: 76,591,843		probably benign	Het
Ciita	A	T	16: 10,509,401	I277F	possibly damaging	Het
Col15a1	T	C	4: 47,296,112	V943A	possibly damaging	Het
Coq2	G	A	5: 100,657,832	H313Y	possibly damaging	Het
Csn3	C	T	5: 87,929,835	P67S	probably benign	Het
Csrnp3	A	G	2: 66,022,340	T359A	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,005,041	L509P	probably damaging	Het
Dclk3	A	G	9: 111,468,681	D431G	probably benign	Het
Dtx3l	A	T	16: 35,933,238	C333S	possibly damaging	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Fam171a1	G	C	2: 3,178,353	G72A	probably damaging	Het
Fbxw17	T	C	13: 50,432,354		probably benign	Het
Fry	A	G	5: 150,469,720	D605G	possibly damaging	Het
Fyn	T	C	10: 39,529,940	F240S	probably benign	Het
Gcfc2	T	C	6: 81,953,290	L646P	probably damaging	Het
Gm5087	C	T	14: 13,158,788		noncoding transcript	Het
Got2	T	A	8: 95,875,849	N91I	probably benign	Het
Hspa4	C	T	11: 53,286,975	V103I	possibly damaging	Het
Itgad	A	G	7: 128,193,428		probably null	Het
Krt33a	A	G	11: 100,014,135	S182P	probably damaging	Het
Mcph1	T	C	8: 18,671,238	I694T	probably damaging	Het
Mmp15	T	C	8: 95,371,068	V502A	probably benign	Het
Mov10l1	T	C	15: 88,983,032	V23A	probably benign	Het
Myo9a	T	A	9: 59,910,617	N2322K	probably damaging	Het
Ndst4	A	G	3: 125,710,117	Y11C	probably damaging	Het
Nell1	T	C	7: 50,176,314	F199S	probably damaging	Het
Nup210	C	T	6: 91,026,969	V646M	probably damaging	Het
Nup98	A	T	7: 102,195,822	S13R	unknown	Het
Nxf1	T	C	19: 8,763,929	I54T	possibly damaging	Het
Olfr885	A	G	9: 38,062,150	T277A	probably damaging	Het
Pcdh10	C	A	3: 45,384,191	R928S	probably damaging	Het
Pou3f3	A	G	1: 42,698,278	N378S	probably benign	Het
Rorc	T	A	3: 94,397,325	V339D	probably benign	Het
Scin	T	A	12: 40,077,559	I411F	probably benign	Het
Serpind1	A	G	16: 17,336,894	Y195C	probably damaging	Het
Tas2r117	T	C	6: 132,803,622	V241A	possibly damaging	Het
Tet3	T	A	6: 83,386,063	E709V	probably damaging	Het
Trbc1	T	A	6: 41,538,449		probably benign	Het
Vmn1r212	C	A	13: 22,883,134	G343V	unknown	Het
Vmn2r42	T	A	7: 8,194,838	K261*	probably null	Het
Xrcc5	T	A	1: 72,340,050	L438Q	probably damaging	Het
Zfp142	T	C	1: 74,585,449	N72S	probably damaging	Het
Zfp292	A	T	4: 34,809,755	S1096R	probably damaging	Het

Other mutations in Rfx6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Rfx6	APN	10	51681886	missense	probably damaging	1.00
IGL00816:Rfx6	APN	10	51678405	missense	probably benign	0.16
IGL01639:Rfx6	APN	10	51715906	nonsense	probably null
IGL01721:Rfx6	APN	10	51723077	missense	probably damaging	1.00
IGL01861:Rfx6	APN	10	51721579	missense	probably damaging	1.00
IGL02103:Rfx6	APN	10	51726856	missense	possibly damaging	0.93
IGL02113:Rfx6	APN	10	51678012	missense	probably benign
IGL02479:Rfx6	APN	10	51678328	missense	probably benign	0.07
IGL02592:Rfx6	APN	10	51716023	missense	probably damaging	1.00
IGL02635:Rfx6	APN	10	51716026	missense	possibly damaging	0.80
IGL02891:Rfx6	APN	10	51723846	missense	possibly damaging	0.64
IGL03153:Rfx6	APN	10	51723121	nonsense	probably null
IGL03263:Rfx6	APN	10	51725807	missense	probably benign	0.00
IGL03373:Rfx6	APN	10	51720000	missense	probably damaging	0.99
bulky	UTSW	10	51678333	missense	probably benign	0.00
R0060:Rfx6	UTSW	10	51677840	missense	probably benign	0.00
R0433:Rfx6	UTSW	10	51720028	missense	probably damaging	1.00
R1329:Rfx6	UTSW	10	51693737	missense	probably damaging	1.00
R1709:Rfx6	UTSW	10	51678402	missense	possibly damaging	0.64
R1820:Rfx6	UTSW	10	51723125	critical splice donor site	probably null
R2017:Rfx6	UTSW	10	51721604	missense	possibly damaging	0.50
R2020:Rfx6	UTSW	10	51720057	critical splice donor site	probably null
R2044:Rfx6	UTSW	10	51718126	missense	probably benign	0.16
R2495:Rfx6	UTSW	10	51726675	splice site	probably benign
R2655:Rfx6	UTSW	10	51693777	splice site	probably benign
R2912:Rfx6	UTSW	10	51718130	missense	probably damaging	1.00
R3159:Rfx6	UTSW	10	51726720	missense	probably damaging	1.00
R4036:Rfx6	UTSW	10	51726746	missense	probably damaging	1.00
R4536:Rfx6	UTSW	10	51723784	missense	probably benign	0.16
R4791:Rfx6	UTSW	10	51719944	splice site	probably null
R4945:Rfx6	UTSW	10	51726851	nonsense	probably null
R5223:Rfx6	UTSW	10	51677996	nonsense	probably null
R5448:Rfx6	UTSW	10	51683637	missense	probably damaging	1.00
R5600:Rfx6	UTSW	10	51723061	missense	probably damaging	1.00
R5768:Rfx6	UTSW	10	51726880	missense	probably damaging	0.99
R5858:Rfx6	UTSW	10	51725868	missense	probably benign	0.00
R5949:Rfx6	UTSW	10	51678333	missense	probably benign	0.00
R6001:Rfx6	UTSW	10	51718211	splice site	probably null
R6003:Rfx6	UTSW	10	51708587	missense	probably damaging	1.00
R6118:Rfx6	UTSW	10	51711866	missense	possibly damaging	0.91
R6629:Rfx6	UTSW	10	51725490	missense	probably benign	0.02
R6876:Rfx6	UTSW	10	51719991	missense	probably damaging	1.00
R6894:Rfx6	UTSW	10	51716039	missense	probably damaging	1.00
R6912:Rfx6	UTSW	10	51723853	missense	probably benign	0.00
R7130:Rfx6	UTSW	10	51678380	nonsense	probably null
R7574:Rfx6	UTSW	10	51681818	missense	probably benign	0.17
V8831:Rfx6	UTSW	10	51718208	critical splice donor site	probably null
X0023:Rfx6	UTSW	10	51678411	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGAGTTGACTGAATGCTTC -3'
(R):5'- TGTTCCCTGAGAATTTAGATGCC -3'

Sequencing Primer
(F):5'- GAGTTGACTGAATGCTTCTCTATGAC -3'
(R):5'- CCCTGAGAATTTAGATGCCATATC -3'

Posted On

2016-07-06