Incidental Mutation 'R5233:Acsl6'
ID398148
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Nameacyl-CoA synthetase long-chain family member 6
SynonymsLacsl, Facl6, A330035H04Rik
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54303798-54364756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54325606 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 200 (V200I)
Ref Sequence ENSEMBL: ENSMUSP00000104532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108899] [ENSMUST00000108904] [ENSMUST00000108905] [ENSMUST00000138515] [ENSMUST00000149403] [ENSMUST00000156252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000145
AA Change: V140I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: V140I

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064690
AA Change: V175I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072178
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093106
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094194
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101211
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101213
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108899
AA Change: V175I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108904
AA Change: V200I

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: V200I

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108905
AA Change: V200I

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: V200I

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138515
AA Change: V175I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333
AA Change: V175I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156252
AA Change: V140I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333
AA Change: V140I

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Meta Mutation Damage Score 0.1439 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Rorc T A 3: 94,397,325 V339D probably benign Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54350580 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54325564 missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1697:Acsl6 UTSW 11 54329966 missense probably damaging 1.00
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4450:Acsl6 UTSW 11 54328403 missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 unclassified probably null
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R5749:Acsl6 UTSW 11 54324055 critical splice donor site probably null
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGGGTTAAACTCTAGCG -3'
(R):5'- GCCATCGTATAAGCCCCTAGTG -3'

Sequencing Primer
(F):5'- GTAGCAAGCGTCATCTGAGTC -3'
(R):5'- GGATTTCAGACATGTGCCAC -3'
Posted On2016-07-06