Incidental Mutation 'R5234:Espnl'
ID398173
Institutional Source Beutler Lab
Gene Symbol Espnl
Ensembl Gene ENSMUSG00000049515
Gene Nameespin-like
SynonymsLOC227357
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score203
Status Not validated
Chromosome1
Chromosomal Location91322075-91348306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91344793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 581 (D581G)
Ref Sequence ENSEMBL: ENSMUSP00000135828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088904] [ENSMUST00000176156]
Predicted Effect probably benign
Transcript: ENSMUST00000088904
AA Change: D625G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086294
Gene: ENSMUSG00000049515
AA Change: D625G

DomainStartEndE-ValueType
Blast:ANK 1 33 4e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
ANK 270 299 1.96e-3 SMART
ANK 303 332 3.21e1 SMART
low complexity region 336 345 N/A INTRINSIC
coiled coil region 509 538 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176156
AA Change: D581G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135828
Gene: ENSMUSG00000049515
AA Change: D581G

DomainStartEndE-ValueType
Blast:ANK 1 33 5e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
low complexity region 292 301 N/A INTRINSIC
coiled coil region 465 494 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Espnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Espnl APN 1 91340611 nonsense probably null
IGL01726:Espnl APN 1 91344904 missense probably benign
IGL02402:Espnl APN 1 91344813 missense probably benign 0.13
IGL02472:Espnl APN 1 91340534 missense probably benign 0.02
IGL02986:Espnl APN 1 91344850 missense probably benign 0.01
IGL03037:Espnl APN 1 91341921 missense probably benign 0.01
IGL03073:Espnl APN 1 91344556 missense probably damaging 0.99
R0111:Espnl UTSW 1 91344742 missense probably benign 0.29
R0197:Espnl UTSW 1 91344489 missense probably damaging 1.00
R0238:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0665:Espnl UTSW 1 91334687 intron probably null
R1772:Espnl UTSW 1 91344603 missense possibly damaging 0.61
R3804:Espnl UTSW 1 91322221 missense probably benign 0.00
R4352:Espnl UTSW 1 91334721 missense probably damaging 1.00
R4566:Espnl UTSW 1 91344579 missense possibly damaging 0.46
R4790:Espnl UTSW 1 91344424 missense probably damaging 1.00
R6430:Espnl UTSW 1 91322248 missense possibly damaging 0.75
R6652:Espnl UTSW 1 91344699 missense probably benign 0.13
R6785:Espnl UTSW 1 91322221 missense probably benign 0.00
R6800:Espnl UTSW 1 91342629 missense probably damaging 0.98
R7082:Espnl UTSW 1 91334799 missense probably benign 0.00
R7311:Espnl UTSW 1 91323568 missense probably damaging 0.98
R7376:Espnl UTSW 1 91322314 missense probably damaging 1.00
R7880:Espnl UTSW 1 91344766 missense possibly damaging 0.81
R8154:Espnl UTSW 1 91325199 missense possibly damaging 0.87
Z1177:Espnl UTSW 1 91323555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGGAGAAGCAGATCAACG -3'
(R):5'- AGCAACCTCTCAGACACTGG -3'

Sequencing Primer
(F):5'- TGGTCAGCATCACCGTCAAC -3'
(R):5'- TCTCAGACACTGGCCAGG -3'
Posted On2016-07-06