Incidental Mutation 'R5234:Olfr357'
ID398182
Institutional Source Beutler Lab
Gene Symbol Olfr357
Ensembl Gene ENSMUSG00000055838
Gene Nameolfactory receptor 357
SynonymsGA_x6K02T2NLDC-33688556-33689482, MOR138-3
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36993827-37001847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36997095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 95 (V95A)
Ref Sequence ENSEMBL: ENSMUSP00000149727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069578] [ENSMUST00000213218]
Predicted Effect probably benign
Transcript: ENSMUST00000069578
AA Change: V95A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066272
Gene: ENSMUSG00000055838
AA Change: V95A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-53 PFAM
Pfam:7tm_1 41 290 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213218
AA Change: V95A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Olfr357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Olfr357 APN 2 36996943 missense probably benign
IGL02043:Olfr357 APN 2 36997465 nonsense probably null
IGL02277:Olfr357 APN 2 36997184 unclassified probably null
IGL03037:Olfr357 APN 2 36997548 missense probably benign 0.00
IGL03378:Olfr357 APN 2 36996903 missense probably damaging 1.00
R0212:Olfr357 UTSW 2 36997323 missense probably damaging 0.98
R0212:Olfr357 UTSW 2 36997632 missense possibly damaging 0.92
R1334:Olfr357 UTSW 2 36996860 missense probably benign 0.27
R1704:Olfr357 UTSW 2 36996884 missense probably benign 0.34
R2020:Olfr357 UTSW 2 36997652 missense possibly damaging 0.85
R2364:Olfr357 UTSW 2 36997565 missense probably damaging 1.00
R4700:Olfr357 UTSW 2 36997503 missense probably benign 0.01
R5105:Olfr357 UTSW 2 36997457 unclassified probably null
R5557:Olfr357 UTSW 2 36997346 missense probably damaging 1.00
R5966:Olfr357 UTSW 2 36996945 missense possibly damaging 0.96
R6480:Olfr357 UTSW 2 36996995 missense probably benign 0.00
R7046:Olfr357 UTSW 2 36997161 missense probably benign 0.39
R7350:Olfr357 UTSW 2 36996861 missense possibly damaging 0.84
R7583:Olfr357 UTSW 2 36997080 missense probably damaging 1.00
R8128:Olfr357 UTSW 2 36997661 missense probably benign 0.13
R8196:Olfr357 UTSW 2 36996861 missense possibly damaging 0.84
Z1088:Olfr357 UTSW 2 36997705 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTACTAACCCAGTTGAACAGATTCC -3'
(R):5'- GAGGACATGACATAGAGCCACC -3'

Sequencing Primer
(F):5'- AGTTGAACAGATTCCTCTCTTCC -3'
(R):5'- TGACATAGAGCCACCATCTGTG -3'
Posted On2016-07-06