Incidental Mutation 'R5234:Olfr1145'
ID398184
Institutional Source Beutler Lab
Gene Symbol Olfr1145
Ensembl Gene ENSMUSG00000068814
Gene Nameolfactory receptor 1145
SynonymsGA_x6K02T2Q125-49311440-49312384, MOR264-19
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87809822-87810799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87810768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
Predicted Effect probably benign
Transcript: ENSMUST00000079711
AA Change: V305A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: V305A

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090707
AA Change: V316A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: V316A

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Olfr1145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr1145 APN 2 87810648 missense probably damaging 1.00
IGL01335:Olfr1145 APN 2 87810446 missense probably damaging 1.00
PIT4418001:Olfr1145 UTSW 2 87810594 missense probably damaging 0.99
R1512:Olfr1145 UTSW 2 87810644 missense probably benign 0.23
R1700:Olfr1145 UTSW 2 87810768 missense probably benign
R2127:Olfr1145 UTSW 2 87810341 missense probably benign 0.09
R2162:Olfr1145 UTSW 2 87810360 missense probably damaging 1.00
R3707:Olfr1145 UTSW 2 87810176 missense probably damaging 1.00
R4327:Olfr1145 UTSW 2 87810152 missense probably benign 0.00
R4422:Olfr1145 UTSW 2 87810645 missense probably damaging 0.97
R4854:Olfr1145 UTSW 2 87810590 missense probably damaging 1.00
R5858:Olfr1145 UTSW 2 87810641 missense probably benign 0.22
R6229:Olfr1145 UTSW 2 87810087 missense probably damaging 1.00
R6991:Olfr1145 UTSW 2 87810443 missense possibly damaging 0.76
R7007:Olfr1145 UTSW 2 87809886 missense probably damaging 1.00
R7027:Olfr1145 UTSW 2 87810716 missense possibly damaging 0.90
R7260:Olfr1145 UTSW 2 87810387 missense probably damaging 0.98
R7624:Olfr1145 UTSW 2 87810339 missense probably damaging 1.00
R7794:Olfr1145 UTSW 2 87810474 missense probably damaging 0.97
R8029:Olfr1145 UTSW 2 87810032 missense probably benign 0.00
Z1088:Olfr1145 UTSW 2 87810746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAAAGCCTTCTCCACTTG -3'
(R):5'- CTCATTGAAGATGAATGACCTTGCC -3'

Sequencing Primer
(F):5'- AAAAGCCTTCTCCACTTGTTCTTC -3'
(R):5'- TGACCTTGCCTAATACTAAGAGGC -3'
Posted On2016-07-06