Incidental Mutation 'R5191:Kcnj2'
ID398185
Institutional Source Beutler Lab
Gene Symbol Kcnj2
Ensembl Gene ENSMUSG00000041695
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 2
SynonymsIRK1, Kcnf1, Kir2.1
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location111066164-111076821 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 111072471 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 230 (Q230*)
Ref Sequence ENSEMBL: ENSMUSP00000037192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042970]
PDB Structure
Crystal Structure of Cytoplasmic Domains of IRK1 (Kir2.1) channel [X-RAY DIFFRACTION]
Cytoplasmic Domain Structure of Kir2.1 containing Andersen's Mutation R218Q and Rescue Mutation T309K [X-RAY DIFFRACTION]
Single particle analysis of Kir2.1NC_4 in negative stain [SOLUTION SCATTERING, ELECTRON MICROSCOPY]
Predicted Effect probably null
Transcript: ENSMUST00000042970
AA Change: Q230*
SMART Domains Protein: ENSMUSP00000037192
Gene: ENSMUSG00000041695
AA Change: Q230*

DomainStartEndE-ValueType
Pfam:IRK_N 1 47 2.9e-29 PFAM
Pfam:IRK 48 373 7.3e-158 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die within 8-12 hours after birth, displaying cyanosis and respiratory distress, as well as complete cleft of the secondary palate, and loss of K+-mediated vasodilatation in cerebral arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Kcnj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kcnj2 APN 11 111071827 missense probably damaging 1.00
IGL02448:Kcnj2 APN 11 111072282 missense probably benign 0.00
R0090:Kcnj2 UTSW 11 111073027 missense probably benign 0.02
R1162:Kcnj2 UTSW 11 111072967 missense probably benign
R1990:Kcnj2 UTSW 11 111072883 missense probably benign 0.00
R3948:Kcnj2 UTSW 11 111072655 missense possibly damaging 0.73
R4417:Kcnj2 UTSW 11 111072189 missense probably damaging 1.00
R4605:Kcnj2 UTSW 11 111072850 missense probably damaging 1.00
R5439:Kcnj2 UTSW 11 111072231 missense probably damaging 1.00
R5530:Kcnj2 UTSW 11 111072091 missense probably damaging 1.00
R6167:Kcnj2 UTSW 11 111072489 missense probably benign
R7126:Kcnj2 UTSW 11 111072822 missense probably damaging 1.00
R7713:Kcnj2 UTSW 11 111072483 missense probably benign 0.00
X0052:Kcnj2 UTSW 11 111071856 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCATCATTGGTGCAGTCATGG -3'
(R):5'- TGAGTTGTCATGGCAGTCGC -3'

Sequencing Primer
(F):5'- CATTGGTGCAGTCATGGCGAAG -3'
(R):5'- CAAAGTCTGCATTGTCAATGTCCTG -3'
Posted On2016-07-06