Incidental Mutation 'R5234:Ncoa6'
ID398188
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155438013 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 28 (F28L)
Ref Sequence ENSEMBL: ENSMUSP00000118113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109669] [ENSMUST00000109670] [ENSMUST00000123293]
Predicted Effect probably benign
Transcript: ENSMUST00000043126
AA Change: F28L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: F28L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109669
AA Change: F28L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105294
Gene: ENSMUSG00000038369
AA Change: F28L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.6e-61 PFAM
SCOP:d1lsha3 239 321 5e-3 SMART
low complexity region 375 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109670
AA Change: F28L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: F28L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123293
AA Change: F28L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369
AA Change: F28L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.4e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
low complexity region 564 573 N/A INTRINSIC
low complexity region 615 630 N/A INTRINSIC
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134508
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
mauna_loa UTSW 2 155415227 missense probably damaging 0.99
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0652:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1110:Ncoa6 UTSW 2 155411520 splice site probably benign
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3618:Ncoa6 UTSW 2 155407789 missense possibly damaging 0.95
R3747:Ncoa6 UTSW 2 155411641 missense probably benign 0.01
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 unclassified probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5579:Ncoa6 UTSW 2 155406677 missense probably damaging 1.00
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
R7385:Ncoa6 UTSW 2 155407801 missense probably damaging 1.00
RF033:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF040:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF048:Ncoa6 UTSW 2 155421712 small deletion probably benign
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Z1176:Ncoa6 UTSW 2 155421302 missense probably damaging 0.99
Z1177:Ncoa6 UTSW 2 155406142 missense possibly damaging 0.67
Z1177:Ncoa6 UTSW 2 155421218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGTAGGCAAGTAAGCATGTC -3'
(R):5'- GAGCACTGCTAACACTCAGATC -3'

Sequencing Primer
(F):5'- TTGTAGGCAAGTAAGCATGTCAAAGC -3'
(R):5'- GGTTTTGGATGACCTTCC -3'
Posted On2016-07-06