Incidental Mutation 'R5191:Lpin1'
ID398189
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16580828 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 23 (N23S)
Ref Sequence ENSEMBL: ENSMUSP00000152209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221146] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067124
AA Change: N23S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: N23S

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111067
AA Change: N23S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: N23S

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221146
AA Change: N23S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221230
AA Change: N23S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221297
AA Change: N23S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222989
AA Change: N23S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.8681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
R7557:Lpin1 UTSW 12 16580792 missense
Predicted Primers PCR Primer
(F):5'- CAACGAGGCTTCTTGTGAGTC -3'
(R):5'- AATGTGTTCCGCTGCATCG -3'

Sequencing Primer
(F):5'- TCTTGTGAGTCTGAGGAGAGGAGAG -3'
(R):5'- CCGCTGCATCGTTGAAAC -3'
Posted On2016-07-06