Incidental Mutation 'R5191:Sptb'
ID398191
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76612834 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1097 (E1097D)
Ref Sequence ENSEMBL: ENSMUSP00000021458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably benign
Transcript: ENSMUST00000021458
AA Change: E1097D

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: E1097D

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166101
AA Change: E1097D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: E1097D

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Meta Mutation Damage Score 0.0956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
X0057:Sptb UTSW 12 76630739 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTAGAGCATCCCAGTCAGTATC -3'
(R):5'- CTTGATGGAGTCACACCCTG -3'

Sequencing Primer
(F):5'- GAGCATCCCAGTCAGTATCTAGGC -3'
(R):5'- ATGGAGTCACACCCTGAGCAG -3'
Posted On2016-07-06