Incidental Mutation 'R5234:Bcan'
ID398196
Institutional Source Beutler Lab
Gene Symbol Bcan
Ensembl Gene ENSMUSG00000004892
Gene Namebrevican
SynonymsCspg7
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87987531-88000230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87996146 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 246 (D246E)
Ref Sequence ENSEMBL: ENSMUSP00000088491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090971] [ENSMUST00000194193]
Predicted Effect probably damaging
Transcript: ENSMUST00000090971
AA Change: D246E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088491
Gene: ENSMUSG00000004892
AA Change: D246E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 51 138 5.74e-13 SMART
LINK 154 251 9.37e-55 SMART
LINK 255 353 2.67e-59 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
EGF 625 658 1.07e-5 SMART
CLECT 664 785 1.15e-33 SMART
CCP 791 847 2.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193276
Predicted Effect probably benign
Transcript: ENSMUST00000194193
SMART Domains Protein: ENSMUSP00000141455
Gene: ENSMUSG00000004892

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IGv 51 105 1e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194596
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired LTP maintenance, but mutant animals show normal behavior and spatial learning capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Bcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Bcan APN 3 87994174 missense probably damaging 1.00
IGL00981:Bcan APN 3 87997832 missense possibly damaging 0.66
IGL02355:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL02362:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL03190:Bcan APN 3 87993050 unclassified probably benign
R0392:Bcan UTSW 3 87993562 nonsense probably null
R0938:Bcan UTSW 3 87993154 missense possibly damaging 0.96
R1118:Bcan UTSW 3 87989227 missense probably damaging 1.00
R1559:Bcan UTSW 3 87994212 missense probably damaging 0.96
R1653:Bcan UTSW 3 87994196 missense probably damaging 0.99
R1699:Bcan UTSW 3 87989236 missense probably damaging 1.00
R1762:Bcan UTSW 3 87993625 missense probably benign 0.00
R1802:Bcan UTSW 3 87993108 missense possibly damaging 0.58
R1870:Bcan UTSW 3 87995601 missense probably damaging 1.00
R1929:Bcan UTSW 3 87993094 missense probably damaging 1.00
R2172:Bcan UTSW 3 87996581 missense probably damaging 1.00
R2271:Bcan UTSW 3 87993094 missense probably damaging 1.00
R4036:Bcan UTSW 3 87996116 critical splice donor site probably null
R4363:Bcan UTSW 3 87997098 missense probably damaging 1.00
R4491:Bcan UTSW 3 87990233 nonsense probably null
R5111:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5122:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5167:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5363:Bcan UTSW 3 87995487 missense probably damaging 1.00
R5365:Bcan UTSW 3 87989235 missense probably damaging 1.00
R5544:Bcan UTSW 3 87993053 critical splice donor site probably null
R5663:Bcan UTSW 3 87995613 missense probably damaging 0.98
R6044:Bcan UTSW 3 87995643 missense probably damaging 1.00
R6495:Bcan UTSW 3 87996597 missense possibly damaging 0.91
R6725:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R6764:Bcan UTSW 3 87988378 missense probably damaging 1.00
R7000:Bcan UTSW 3 87988379 nonsense probably null
R7294:Bcan UTSW 3 87995524 missense possibly damaging 0.51
R7338:Bcan UTSW 3 87994243 missense probably damaging 1.00
X0013:Bcan UTSW 3 87996159 missense possibly damaging 0.69
Z1176:Bcan UTSW 3 87990750 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87990755 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87995650 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGTCTGCTCAGAGGCTTG -3'
(R):5'- AGAAAATTGGTCTGCAGCTCTG -3'

Sequencing Primer
(F):5'- AGAGGCTTGCCTCTGGGAC -3'
(R):5'- AGCTCTGCCTGGGCCTTAC -3'
Posted On2016-07-06