Incidental Mutation 'R5191:Acvrl1'
ID398205
Institutional Source Beutler Lab
Gene Symbol Acvrl1
Ensembl Gene ENSMUSG00000000530
Gene Nameactivin A receptor, type II-like 1
SynonymsAlk-1, activin receptor-like kinase-1, Alk1, Acvrlk1
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101128522-101145336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101137065 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000114027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000542] [ENSMUST00000117984] [ENSMUST00000119063] [ENSMUST00000120028] [ENSMUST00000120754] [ENSMUST00000121718] [ENSMUST00000124151] [ENSMUST00000130432] [ENSMUST00000144229]
Predicted Effect probably damaging
Transcript: ENSMUST00000000542
AA Change: E235G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000542
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117984
AA Change: E235G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113505
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
PDB:2LCR|A 19 116 4e-43 PDB
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119063
AA Change: E235G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113536
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120028
AA Change: E235G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113297
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120754
AA Change: E235G

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112490
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121718
AA Change: E235G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114027
Gene: ENSMUSG00000000530
AA Change: E235G

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124151
SMART Domains Protein: ENSMUSP00000114829
Gene: ENSMUSG00000000530

DomainStartEndE-ValueType
PDB:2LCR|A 19 76 8e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128868
Predicted Effect probably benign
Transcript: ENSMUST00000130432
Predicted Effect probably benign
Transcript: ENSMUST00000144229
Meta Mutation Damage Score 0.8184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die at midgestation with severe vascular abnormalities, including fusion of major arteries and veins. Mice heterozygous for one targeted mutation provide a suitable model for hereditary hemorrhagic telangiectasia type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Acvrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Acvrl1 APN 15 101143340 splice site probably null
IGL00780:Acvrl1 APN 15 101137367 missense probably damaging 1.00
IGL01714:Acvrl1 APN 15 101137370 missense probably damaging 1.00
IGL02962:Acvrl1 APN 15 101135501 missense probably benign 0.00
IGL03268:Acvrl1 APN 15 101135922 missense possibly damaging 0.48
IGL03341:Acvrl1 APN 15 101137596 missense probably damaging 1.00
R0256:Acvrl1 UTSW 15 101137121 missense probably damaging 1.00
R0538:Acvrl1 UTSW 15 101136149 missense probably damaging 0.99
R1666:Acvrl1 UTSW 15 101137577 missense probably damaging 1.00
R2402:Acvrl1 UTSW 15 101137399 missense probably damaging 1.00
R3789:Acvrl1 UTSW 15 101137469 missense probably damaging 0.98
R4720:Acvrl1 UTSW 15 101135773 missense probably damaging 1.00
R4844:Acvrl1 UTSW 15 101135528 missense probably damaging 0.98
R4995:Acvrl1 UTSW 15 101135860 missense probably benign 0.00
R5053:Acvrl1 UTSW 15 101137369 missense probably damaging 1.00
R5093:Acvrl1 UTSW 15 101134747 unclassified probably null
R6981:Acvrl1 UTSW 15 101138345 missense probably damaging 1.00
R7224:Acvrl1 UTSW 15 101143364 missense probably benign 0.17
R7231:Acvrl1 UTSW 15 101136223 nonsense probably null
R7326:Acvrl1 UTSW 15 101141072 missense probably damaging 0.97
R7555:Acvrl1 UTSW 15 101143473 missense probably benign 0.05
R7569:Acvrl1 UTSW 15 101135755 missense probably benign 0.00
R7627:Acvrl1 UTSW 15 101135866 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTTTATAGCATCCAGAATTGGGG -3'
(R):5'- GCTCAACCTAAGTACCCAGGAG -3'

Sequencing Primer
(F):5'- CATCCAGAATTGGGGTGGGGTC -3'
(R):5'- TCAACCTAAGTACCCAGGAGGAATG -3'
Posted On2016-07-06