Incidental Mutation 'R0453:Lama3'
ID 39821
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Name laminin, alpha 3
Synonyms [a]3B, nicein, 150kDa
MMRRC Submission 038653-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0453 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 12333819-12583013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12465478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 981 (S981T)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000092070
AA Change: S981T

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: S981T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 splice site probably null
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
R7894:Lama3 UTSW 18 12462807 missense probably benign 0.07
R7975:Lama3 UTSW 18 12537739 missense probably damaging 1.00
R8099:Lama3 UTSW 18 12534063 missense probably damaging 0.97
R8168:Lama3 UTSW 18 12506942 missense probably null
R8219:Lama3 UTSW 18 12439360 missense probably benign 0.07
R8227:Lama3 UTSW 18 12407551 missense probably benign
R8229:Lama3 UTSW 18 12407551 missense probably benign
R8298:Lama3 UTSW 18 12525853 missense probably benign 0.12
R8351:Lama3 UTSW 18 12540613 missense probably damaging 1.00
R8364:Lama3 UTSW 18 12528347 missense probably damaging 0.99
R8463:Lama3 UTSW 18 12449839 missense probably damaging 0.96
R8515:Lama3 UTSW 18 12411631 missense probably null 0.01
R8784:Lama3 UTSW 18 12421155 missense probably benign
R8799:Lama3 UTSW 18 12490943 missense probably damaging 0.96
R8874:Lama3 UTSW 18 12449586 critical splice donor site probably null
R8938:Lama3 UTSW 18 12556705 missense probably damaging 1.00
R8967:Lama3 UTSW 18 12532039 missense possibly damaging 0.46
R9039:Lama3 UTSW 18 12481063 nonsense probably null
R9126:Lama3 UTSW 18 12450470 missense probably damaging 1.00
R9200:Lama3 UTSW 18 12472240 missense probably benign 0.00
R9203:Lama3 UTSW 18 12462812 missense probably benign 0.04
R9246:Lama3 UTSW 18 12577902 missense probably damaging 0.99
R9284:Lama3 UTSW 18 12450484 nonsense probably null
R9553:Lama3 UTSW 18 12429962 missense probably damaging 1.00
R9716:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R9734:Lama3 UTSW 18 12549263 missense possibly damaging 0.94
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12429879 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCTGTACACATGTCCAGCG -3'
(R):5'- AGTAAGCCCTTGGCAATTAGCACTC -3'

Sequencing Primer
(F):5'- GTACACATGTCCAGCGCATTG -3'
(R):5'- GCACTCTTGGGCAAAAAGTTC -3'
Posted On 2013-05-23