Incidental Mutation 'R5234:Pthlh'
ID 398212
Institutional Source Beutler Lab
Gene Symbol Pthlh
Ensembl Gene ENSMUSG00000048776
Gene Name parathyroid hormone-like peptide
Synonyms parathyroid hormone-related protein, Pthrp, parathyroid hormone-like hormone, PTH-related peptide, parathyroid hormone-related peptide, PTH-like
MMRRC Submission 042806-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5234 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 147153607-147165511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 147158592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 123 (G123W)
Ref Sequence ENSEMBL: ENSMUSP00000145509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052296] [ENSMUST00000204197]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052296
AA Change: G123W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051433
Gene: ENSMUSG00000048776
AA Change: G123W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204197
AA Change: G123W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145509
Gene: ENSMUSG00000048776
AA Change: G123W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the parathyroid family of hormones that possesses distinct paracrine and intracrine signaling roles such as regulation of circulating calcium, transplacental calcium transport, osteoclast inhibition, renal bicarbonate excretion and regulation of apoptosis. The encoded protein undergoes proteolytic processing to generate multiple active peptides with distinct signaling functions. The homozygous deletion of this gene leads to death shortly after birth with a chondrodystrophic phenotype characterized by premature chondrocyte differentiation and accelerated bone formation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dischondroplasia associated with premature maturation of chondrocytes and die postnatally from asphyxia. Mutants rescued from neonatal lethality lack mammary development and tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,302,823 (GRCm39) T2132M probably damaging Het
Abca8b A T 11: 109,867,420 (GRCm39) F213I possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adamts6 A G 13: 104,630,130 (GRCm39) Y1091C probably damaging Het
Adamtsl4 T C 3: 95,588,230 (GRCm39) M586V probably benign Het
Anapc4 T C 5: 53,006,118 (GRCm39) S336P probably damaging Het
Atp1a4 A T 1: 172,054,737 (GRCm39) I964K possibly damaging Het
Bcan A T 3: 87,903,453 (GRCm39) D246E probably damaging Het
Ccnf G A 17: 24,453,411 (GRCm39) R343* probably null Het
Col6a5 T C 9: 105,741,404 (GRCm39) H2505R probably damaging Het
Dlg5 T A 14: 24,242,930 (GRCm39) M72L probably damaging Het
Dnajc18 T C 18: 35,816,351 (GRCm39) T196A probably benign Het
Dnajc19 T A 3: 34,112,108 (GRCm39) I146F probably benign Het
Espnl A G 1: 91,272,515 (GRCm39) D581G probably benign Het
Fam167a T C 14: 63,689,787 (GRCm39) L28P probably damaging Het
Fra10ac1 T C 19: 38,204,294 (GRCm39) D94G probably damaging Het
Fut8 A G 12: 77,379,004 (GRCm39) H35R probably benign Het
Gad1-ps T A 10: 99,281,188 (GRCm39) noncoding transcript Het
Garin2 T A 12: 78,762,045 (GRCm39) Y236* probably null Het
Idh2 A T 7: 79,745,853 (GRCm39) V333E probably damaging Het
Inpp5f A G 7: 128,265,407 (GRCm39) I121V probably benign Het
Itga1 A T 13: 115,185,839 (GRCm39) Y54* probably null Het
Lax1 A G 1: 133,608,321 (GRCm39) V140A probably benign Het
Ncoa6 A G 2: 155,279,933 (GRCm39) F28L probably benign Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or1q1 T C 2: 36,887,107 (GRCm39) V95A probably benign Het
Polr2a T C 11: 69,627,666 (GRCm39) I1414V probably benign Het
Ppp1r14b A G 19: 6,954,227 (GRCm39) E115G possibly damaging Het
Prune2 A G 19: 17,096,032 (GRCm39) D512G probably damaging Het
Psmd11 A G 11: 80,319,566 (GRCm39) I19V probably benign Het
Qars1 T A 9: 108,391,364 (GRCm39) L572Q probably damaging Het
Rubcn T C 16: 32,656,828 (GRCm39) I516V probably damaging Het
Sgsm3 A T 15: 80,892,145 (GRCm39) S238C probably damaging Het
Slc25a22 C A 7: 141,014,116 (GRCm39) probably benign Het
Slc4a1 G A 11: 102,252,209 (GRCm39) R5W probably benign Het
Tie1 G A 4: 118,339,959 (GRCm39) T356I probably benign Het
Tnn A T 1: 159,972,569 (GRCm39) H344Q possibly damaging Het
Tnrc6c G T 11: 117,651,555 (GRCm39) V1693F probably benign Het
Topaz1 C T 9: 122,619,258 (GRCm39) T1285M possibly damaging Het
Trank1 A T 9: 111,215,535 (GRCm39) S1822C probably damaging Het
Ttll11 A C 2: 35,830,745 (GRCm39) Y209D probably damaging Het
Unc45a C G 7: 79,978,547 (GRCm39) A634P probably benign Het
Vmn2r4 C T 3: 64,305,878 (GRCm39) V515I possibly damaging Het
Other mutations in Pthlh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Pthlh APN 6 147,154,073 (GRCm39) missense probably benign 0.15
IGL02450:Pthlh APN 6 147,158,666 (GRCm39) missense possibly damaging 0.95
R0847:Pthlh UTSW 6 147,164,766 (GRCm39) critical splice donor site probably null
R2171:Pthlh UTSW 6 147,158,694 (GRCm39) missense probably damaging 1.00
R2174:Pthlh UTSW 6 147,158,510 (GRCm39) missense probably benign 0.00
R3123:Pthlh UTSW 6 147,164,789 (GRCm39) missense probably damaging 0.98
R3124:Pthlh UTSW 6 147,164,789 (GRCm39) missense probably damaging 0.98
R3125:Pthlh UTSW 6 147,164,789 (GRCm39) missense probably damaging 0.98
R4660:Pthlh UTSW 6 147,158,796 (GRCm39) missense probably damaging 1.00
R5244:Pthlh UTSW 6 147,158,651 (GRCm39) missense probably damaging 1.00
R5809:Pthlh UTSW 6 147,158,745 (GRCm39) missense probably damaging 0.99
R6475:Pthlh UTSW 6 147,158,688 (GRCm39) missense probably damaging 0.98
R7548:Pthlh UTSW 6 147,158,653 (GRCm39) missense possibly damaging 0.56
R8144:Pthlh UTSW 6 147,158,663 (GRCm39) missense probably damaging 1.00
Z1177:Pthlh UTSW 6 147,164,840 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGCTGAACACAGTGAACAGTAC -3'
(R):5'- CAAGGGCAAGTCCATCCAAG -3'

Sequencing Primer
(F):5'- TGAACAGTACCTTAAGCTGGGCTC -3'
(R):5'- GTCCATCCAAGACTTGCGC -3'
Posted On 2016-07-06