Incidental Mutation 'R5234:Inpp5f'
ID398218
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Nameinositol polyphosphate-5-phosphatase F
SynonymscI-27, 5830435P03Rik, SAC2
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128611328-128696425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128663683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000045910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138]
Predicted Effect probably benign
Transcript: ENSMUST00000043138
AA Change: I121V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: I121V

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098007
SMART Domains Protein: ENSMUSP00000095616
Gene: ENSMUSG00000042105

DomainStartEndE-ValueType
Pfam:Syja_N 48 410 1.2e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148815
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128664267 missense probably benign 0.04
IGL01316:Inpp5f APN 7 128690706 splice site probably benign
IGL01455:Inpp5f APN 7 128678049 missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128675398 missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128664307 critical splice donor site probably null
IGL01942:Inpp5f APN 7 128667769 missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128685224 missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128695129 missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128664014 missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128682306 missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128694900 missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128685134 missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128692308 missense probably benign 0.39
R0243:Inpp5f UTSW 7 128695183 missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128690668 missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128694583 missense probably benign
R1375:Inpp5f UTSW 7 128664029 nonsense probably null
R1918:Inpp5f UTSW 7 128663969 splice site probably benign
R2307:Inpp5f UTSW 7 128694310 missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128690670 missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128679699 intron probably benign
R4647:Inpp5f UTSW 7 128659109 missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128663987 missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128663725 missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128685129 missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128676727 critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128679831 missense probably damaging 1.00
R6299:Inpp5f UTSW 7 128636160 missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128678056 missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128664078 nonsense probably null
R6545:Inpp5f UTSW 7 128694556 missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128669957 missense probably benign 0.00
R7383:Inpp5f UTSW 7 128694586 missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128694523 missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128667643 missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128694802 missense probably benign
R7912:Inpp5f UTSW 7 128692313 missense probably benign
R8027:Inpp5f UTSW 7 128690673 missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128664267 missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
RF001:Inpp5f UTSW 7 128695083 missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128682297 missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128694949 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCATAGCTATATCCTGCCTGC -3'
(R):5'- CCAAACACAGGACTGTCTTCTG -3'

Sequencing Primer
(F):5'- ATAGCTATATCCTGCCTGCTTAGTC -3'
(R):5'- ACACAGGACTGTCTTCTGATATAC -3'
Posted On2016-07-06