Incidental Mutation 'R5234:Slc25a22'
ID398220
Institutional Source Beutler Lab
Gene Symbol Slc25a22
Ensembl Gene ENSMUSG00000019082
Gene Namesolute carrier family 25 (mitochondrial carrier, glutamate), member 22
Synonyms
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141429744-141437892 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 141434203 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000084436] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000106007] [ENSMUST00000124266] [ENSMUST00000124444] [ENSMUST00000128703] [ENSMUST00000133021] [ENSMUST00000133206] [ENSMUST00000136354] [ENSMUST00000137488] [ENSMUST00000138865] [ENSMUST00000150026] [ENSMUST00000164387] [ENSMUST00000172654] [ENSMUST00000174095] [ENSMUST00000184518] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000201127] [ENSMUST00000201710] [ENSMUST00000201822] [ENSMUST00000202840]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026580
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084436
SMART Domains Protein: ENSMUSP00000081476
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106005
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106007
SMART Domains Protein: ENSMUSP00000101629
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124444
SMART Domains Protein: ENSMUSP00000118591
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
Pfam:CEND1 1 149 1.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132635
Predicted Effect probably benign
Transcript: ENSMUST00000133021
Predicted Effect probably benign
Transcript: ENSMUST00000133206
Predicted Effect probably benign
Transcript: ENSMUST00000136354
SMART Domains Protein: ENSMUSP00000118948
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.2e-25 PFAM
Pfam:Mito_carr 99 206 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137488
SMART Domains Protein: ENSMUSP00000123334
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect probably benign
Transcript: ENSMUST00000138865
SMART Domains Protein: ENSMUSP00000120721
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.4e-25 PFAM
Pfam:Mito_carr 99 214 1.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148100
Predicted Effect probably benign
Transcript: ENSMUST00000150026
Predicted Effect probably benign
Transcript: ENSMUST00000153190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156002
Predicted Effect probably benign
Transcript: ENSMUST00000164387
SMART Domains Protein: ENSMUSP00000131085
Gene: ENSMUSG00000060240

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 80 97 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174095
Predicted Effect probably benign
Transcript: ENSMUST00000184518
SMART Domains Protein: ENSMUSP00000138924
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201072
Predicted Effect probably benign
Transcript: ENSMUST00000201127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201708
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202840
SMART Domains Protein: ENSMUSP00000144384
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 85 5.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial glutamate carrier. Mutations in this gene are associated with early infantile epileptic encephalopathy. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Slc25a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Slc25a22 UTSW 7 141431359 missense probably damaging 1.00
R7125:Slc25a22 UTSW 7 141431742 missense probably damaging 0.98
R7467:Slc25a22 UTSW 7 141433976 missense probably benign 0.32
R7526:Slc25a22 UTSW 7 141431383 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCATTGATGAGCTTGGCCG -3'
(R):5'- TAGGGAGTGAGGGACTTCAC -3'

Sequencing Primer
(F):5'- ATGAGCTTGGCCGGCAGG -3'
(R):5'- TCACGCCCTTGTGAGATGG -3'
Posted On2016-07-06