Incidental Mutation 'R5234:Qars'
ID398223
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Nameglutaminyl-tRNA synthetase
Synonyms1110018N24Rik, 1200016L19Rik
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108507706-108515941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108514165 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 572 (L572Q)
Ref Sequence ENSEMBL: ENSMUSP00000006838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000006851] [ENSMUST00000112155] [ENSMUST00000134939] [ENSMUST00000192819] [ENSMUST00000192932] [ENSMUST00000193258] [ENSMUST00000193348] [ENSMUST00000194045] [ENSMUST00000194385] [ENSMUST00000195513] [ENSMUST00000195563] [ENSMUST00000207790] [ENSMUST00000207810] [ENSMUST00000207862] [ENSMUST00000207947] [ENSMUST00000208162] [ENSMUST00000208177] [ENSMUST00000208214] [ENSMUST00000208581]
Predicted Effect probably damaging
Transcript: ENSMUST00000006838
AA Change: L572Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604
AA Change: L572Q

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123316
AA Change: L403Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115967
Gene: ENSMUSG00000032604
AA Change: L403Q

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R2 2 87 9.3e-25 PFAM
Pfam:tRNA-synt_1c 94 394 2.6e-115 PFAM
Pfam:tRNA-synt_1c_C 396 583 4.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131005
Predicted Effect unknown
Transcript: ENSMUST00000134939
AA Change: L548Q
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604
AA Change: L548Q

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141780
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192659
Predicted Effect probably benign
Transcript: ENSMUST00000192819
SMART Domains Protein: ENSMUSP00000142027
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 85 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192932
SMART Domains Protein: ENSMUSP00000141215
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193258
SMART Domains Protein: ENSMUSP00000141267
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193348
SMART Domains Protein: ENSMUSP00000141691
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 80 96 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194045
AA Change: L34Q
Predicted Effect probably benign
Transcript: ENSMUST00000194385
SMART Domains Protein: ENSMUSP00000142211
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1cy5a_ 9 45 8e-3 SMART
low complexity region 79 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194743
Predicted Effect probably benign
Transcript: ENSMUST00000195513
SMART Domains Protein: ENSMUSP00000142025
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195563
SMART Domains Protein: ENSMUSP00000141716
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207126
Predicted Effect probably benign
Transcript: ENSMUST00000207180
Predicted Effect probably benign
Transcript: ENSMUST00000207713
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect probably benign
Transcript: ENSMUST00000207810
Predicted Effect probably benign
Transcript: ENSMUST00000207862
Predicted Effect probably benign
Transcript: ENSMUST00000207947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208069
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect probably benign
Transcript: ENSMUST00000208177
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect unknown
Transcript: ENSMUST00000208506
AA Change: L13Q
Predicted Effect probably benign
Transcript: ENSMUST00000208581
Predicted Effect probably benign
Transcript: ENSMUST00000208962
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R0576:Qars UTSW 9 108514962 intron probably benign
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 unclassified probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R1981:Qars UTSW 9 108515028 missense probably damaging 1.00
R2172:Qars UTSW 9 108509200 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R5817:Qars UTSW 9 108510242 unclassified probably benign
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
R7813:Qars UTSW 9 108509471 missense probably damaging 1.00
R8248:Qars UTSW 9 108509452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGGCTATCAACAACTTCTGTG -3'
(R):5'- AAGGAACCTGGTGGAAACCC -3'

Sequencing Primer
(F):5'- AACAACTTCTGTGCTCGGG -3'
(R):5'- GTGGAAACCCTTGGTCTCATCAG -3'
Posted On2016-07-06