Incidental Mutation 'R5234:Psmd11'
ID398230
Institutional Source Beutler Lab
Gene Symbol Psmd11
Ensembl Gene ENSMUSG00000017428
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms1700089D09Rik, 2810055C24Rik, P44.5, C78232, 2610024G20Rik, S9, 1810019E17Rik
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5234 (G1)
Quality Score195
Status Not validated
Chromosome11
Chromosomal Location80428615-80473248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80428740 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 19 (I19V)
Ref Sequence ENSEMBL: ENSMUSP00000133442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000172615] [ENSMUST00000172773] [ENSMUST00000172847] [ENSMUST00000173186] [ENSMUST00000173565] [ENSMUST00000173938] [ENSMUST00000174743]
Predicted Effect probably benign
Transcript: ENSMUST00000017572
AA Change: I26V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428
AA Change: I26V

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147898
Predicted Effect probably benign
Transcript: ENSMUST00000172615
AA Change: I26V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134129
Gene: ENSMUSG00000017428
AA Change: I26V

DomainStartEndE-ValueType
PDB:3TXN|A 37 106 1e-22 PDB
Blast:PAM 83 106 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172641
Predicted Effect probably benign
Transcript: ENSMUST00000172773
AA Change: I26V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134096
Gene: ENSMUSG00000017428
AA Change: I26V

DomainStartEndE-ValueType
PDB:3TXN|A 37 110 7e-24 PDB
Blast:PAM 83 110 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172847
AA Change: I19V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134136
Gene: ENSMUSG00000017428
AA Change: I19V

DomainStartEndE-ValueType
PDB:3TXN|A 30 99 2e-22 PDB
Blast:PAM 76 99 1e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000173060
AA Change: I17V
SMART Domains Protein: ENSMUSP00000133509
Gene: ENSMUSG00000017428
AA Change: I17V

DomainStartEndE-ValueType
PDB:3TXN|A 29 98 2e-22 PDB
Blast:PAM 75 98 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173186
AA Change: I19V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000173565
SMART Domains Protein: ENSMUSP00000134326
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 1 114 2e-50 PDB
Blast:PAM 45 114 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173938
AA Change: I26V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133571
Gene: ENSMUSG00000017428
AA Change: I26V

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174743
AA Change: I19V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Psmd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Psmd11 APN 11 80470384 missense possibly damaging 0.88
IGL03383:Psmd11 APN 11 80469845 missense probably damaging 1.00
R0358:Psmd11 UTSW 11 80462684 splice site probably benign
R0529:Psmd11 UTSW 11 80470689 unclassified probably benign
R1127:Psmd11 UTSW 11 80471584 missense possibly damaging 0.89
R1936:Psmd11 UTSW 11 80428744 missense probably damaging 1.00
R1985:Psmd11 UTSW 11 80445263 missense probably damaging 1.00
R2356:Psmd11 UTSW 11 80428704 missense possibly damaging 0.89
R2994:Psmd11 UTSW 11 80460667 missense probably damaging 1.00
R4898:Psmd11 UTSW 11 80438320 missense probably damaging 1.00
R5173:Psmd11 UTSW 11 80460740 missense probably benign 0.01
R5794:Psmd11 UTSW 11 80471492 missense probably benign 0.00
R6169:Psmd11 UTSW 11 80460713 missense probably damaging 1.00
R6266:Psmd11 UTSW 11 80445941 missense probably benign 0.01
R6275:Psmd11 UTSW 11 80438632 intron probably benign
R7121:Psmd11 UTSW 11 80438273 nonsense probably null
R7318:Psmd11 UTSW 11 80456302 missense probably benign 0.29
R7769:Psmd11 UTSW 11 80434582 intron probably benign
R8250:Psmd11 UTSW 11 80445926 missense possibly damaging 0.68
Z1088:Psmd11 UTSW 11 80471550 frame shift probably null
Z1176:Psmd11 UTSW 11 80428648 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGAGACTACAACTCCCGG -3'
(R):5'- TAACAACGGCGGGAAATGTC -3'

Sequencing Primer
(F):5'- TACAACTCCCGGGGTGCTC -3'
(R):5'- AAATGTCAGTCCTGCGCG -3'
Posted On2016-07-06