Incidental Mutation 'R5203:Fam171a1'
ID 398231
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission 042778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R5203 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3223545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 311 (I311T)
Ref Sequence ENSEMBL: ENSMUSP00000053619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: I311T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: I311T

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072955
AA Change: I191T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: I191T

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: I316T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: I316T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T G 16: 4,835,598 S4A unknown Het
Adgrv1 A T 13: 81,510,905 N2053K possibly damaging Het
Akr1c13 C T 13: 4,197,897 R223* probably null Het
Arhgef11 A G 3: 87,735,357 Y1370C probably damaging Het
Arid1a T C 4: 133,682,003 E1731G unknown Het
Cyp2c54 A T 19: 40,072,474 V75E probably damaging Het
Fa2h A G 8: 111,349,364 M209T probably benign Het
Fat3 C A 9: 16,378,142 L28F possibly damaging Het
Fntb C A 12: 76,837,572 P22Q probably benign Het
Gmeb1 T C 4: 132,232,009 probably null Het
Gpr22 A G 12: 31,709,788 S112P probably damaging Het
Htr7 A G 19: 35,964,392 S464P probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Krt79 A G 15: 101,929,740 S527P unknown Het
Lnpep A T 17: 17,537,063 D858E probably damaging Het
Ly9 C A 1: 171,599,779 V403F probably damaging Het
Mindy4 A G 6: 55,255,661 Q363R probably benign Het
Mtmr10 G A 7: 64,318,161 V273I probably benign Het
Mup2 T A 4: 60,139,728 E20V probably damaging Het
Myo16 A G 8: 10,360,995 N151S probably damaging Het
Nod2 A C 8: 88,664,451 D462A probably damaging Het
Nt5c2 A G 19: 46,889,808 Y497H probably damaging Het
Olfr102 A T 17: 37,314,201 L61Q probably damaging Het
Olfr1294 A C 2: 111,537,636 Y218D probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhac1 A T 18: 37,091,190 D352V probably damaging Het
Psap A G 10: 60,294,975 D195G probably damaging Het
Scyl1 G A 19: 5,771,367 probably benign Het
Sh3bgr A G 16: 96,224,520 probably benign Het
Slc2a12 G T 10: 22,645,314 probably null Het
Slc2a12 G C 10: 22,692,218 V515L probably benign Het
Ttc17 T C 2: 94,378,716 Y131C probably damaging Het
Ttc27 A G 17: 74,777,654 D419G probably damaging Het
Ubxn8 T C 8: 33,633,611 E100G probably damaging Het
Zpbp T C 11: 11,408,451 E272G probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAACAGCCATCGTGTCTCTG -3'
(R):5'- TGGGGTCATTTGCAACTTACATTAC -3'

Sequencing Primer
(F):5'- AGCCATCGTGTCTCTGACCAG -3'
(R):5'- TGCATTCTAGGTAATTTTCCATGAG -3'
Posted On 2016-07-06